Show your work! 8. In an NMR study of a sample of polystyrene, it was determined that (mm) = 0.40 and (mr) = 0.10. What is the % isotacticity of this sample? А. 25% В. 50% C. 45% D. 30%

Q: d. Which average molecular weight determination did the fraction 3 most significantly affect and…

A: We have to give the answer of the given questions. D. We have to tell which molecular weight…

Q: It is intended to toughen poly(methyl methacrylate) (PMMA) by the addition of particles of rubbery…

A: No, I would not expect the material to retain its clarity. This is because of reasons written in 2…

Q: What is the main advantage of the ion sputtering method, compared to the inert-gas condensation…

A: Ion sputtering method and Inert gas condensation method are the techniques used for the synthesis of…

Q: you've been tasked to compound 30 grams of a 0.5% Zinc oxide ointment. you have a stock preparation…

A: The formula used to calculate the amount need to be dilute is as follows: Amount need to be dilute =…

Q: The mol/L concentrations of styrene (M1) and acrylonitrile (M2) used for copolymerization, and % by…

A:

Q: A student determines that the melting range of their solid unknown is 105-107 °C. This melting range…

A:

Q: (2) If equal weights of polymer A and polymer B are mixed, Calculate M, and M, of the m ixture…

A: Answer :-  1. Mn (Mixture) = 56722  2. Mw (Mixture) = 195000…

Q: The length of a polymer chain is commonly expressed by the degree of polymerization (D.P.) which is…

A: Welcome to bartleby ! As per company norms we cannot solve more than one question per session .so ,I…

Q: High L/G ratios result in high operating costs of SO2 scrubbing. Why?

A: Generally, incinerators or large furnace and fossil-fuel power plants consist of SO2 scrubbing…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Show the steps required to ochive structure 8 from Structure A NO2 Starture A

A:

Q: Styrene (3.0 M) is copolymerized with methacrylonitrile (1.5 M) in benzene solution by adding…

A: Note: We are authorized to answer three subparts at a time, since you have not mentioned which part…

Q: Two samples of polystyrene, samples A and B, were synthesised. A from the addition of n- butyl…

A: Introduction: Polymers: Polymers are the large molecules made up of repeating units. The physical…

Q: QUESTION 4-) since the vapor pressure of solid uranium hexafluoride is given as temperatu lependence…

A: Introduction :  We have to calculate enthalpy of sublimation and vapor pressure .

Q: Why does a solid form at the interface of the two solutions?   PROCEDURE Synthesis of Nylon In a…

A: Given that, the synthesis of Nylon-6,10. We have to tell why the solid polymer formed at the…

Q: A-Compare between effective of plasticizers and fillers when add to polymers = B:- Determine values…

A:

Q: A solid sample of one of the following polymers (PETE, PP, PVDC and PTFE) was found to be insoluble…

A: PETE, PVDC and PTFE has either halogen atom like chloro, fluoro group or ester group in monomer unit…

Q: Ver age molecular w levage moleculow w Polymerization. .16 0,28 0.20

A: 1) Number-average molecular weight MN¯ : MN¯ = n1M1 + n2M2 + n3M3 + ....n1 + n2 + n3 + ....  2)…

Q: 17. What is the Ceiling and fluidity temperature ? 18. This polystyrene has a number average…

A: "Since you have asked multiple question, we will solve the first question for you preferably. If you…

Q: Calculate the theoretical yield of the "free radical polymerization of styrene reaction": Amount of…

A: From the given data - Mass of styrene used in the reaction = (Volume)(density) = (2.5 mL)(0.909…

Q: ANION ELIMINATION TEST OBSERVATIONS ADDED REAGENT(S) OBSERVATIONS Ba(NO3)2 NVR HNO3, Fe(NO3)3 Blood…

A: Qualitative analysis of anions.

Q: ) In What order Ufrom highest Rf tolanest Rf) wonld you edpeet to fina 3 compardy Shopn below on a…

A:

Q: (CH,), -N- nylon 6 the O H H (CH,), -C-N-(CH,),2-N- nylon 6,12 In What is the mole fraction of…

A: The number average molecular weight of a polymer can be written as the product of number average…

Q: Identify whether the statements are TRUE or FALSE

A: 1.True

Q: 4- Use Hess's law to calculate the enthalpy change (in kJ/mol) of Alanine oxidation (ΔH1) using the…

A: (1)C3H7NO2(s) + 3O2(g) → 5/2 CO2(g) + 5/2 H2O(l) +1/2 (H2N)C=O(s) ΔH1 =?? (2) (H2N)C=O (s) + 3/2…

Q: (b) Now write a short note on the possible structures of polystyrene as formed from styrene…

A: Polystyrene is a synthetic aromatic hydrocarbon polymer that is prepared from the polymerization of…

Q: A boiler burns fuel oil with 15% excess air. The fuel oil may be presented by C₁₄ H₃₀. Calculate the…

A:

Q: Q14: If you are given 3 samples of polypropylene (pp), one isotactic, one syndiotactic and one a…

A:

Q: ADDED REAGENT(S) OBSERVATIONS Ba(NO3)2 NVR HNO3, Fe(NO3)3 Blood red aqueous layer; pink toluene…

A: Anions can be detected by various reagents such as ferric nitrate, potassium permanganate and barium…

Q: What monomers would you use to produce analogous polyester fibers?

A: Nylon is a synthetic polymer composed of repeating units linked by amide links. Whereas, polyesters…

Q: A 100% 7:06 PM Wed Jan 29 ... Unanswered •1 attempt left • Due on Jan 30 What is the boiling point…

A: Given that molality is 2.065 0.35 m. Elevation in boiling point is determined from the following…

Q: Explain the differences observed in the Tg and Tm values for each pair of polymers: (a) polyester A…

A: (a) The glass transition temperatureTg of Polyester A is less than 0°C and for PET it is 70°C. It…

Q: Write the significance of poly dispersity index; also calculate the number-average molecular weight,…

A: There some small molecules while some are very long molecules, having a molecular weight in…

Q: Briefly describe what is thermoplastic, thermoset plastic and elastomer. Give examples to clarify…

A:

Q: The best answer to report for 352.94 – 36.0342 is ?

A: The result of addition or subtraction cannot have more digits to the right decimal point than the…

Q: One hundred liters of methyl methacrylate containing 10.2 moles of an initiator (t1 / 2 = 50 h) in…

A: The rate of polymerization in a free radical polymerization depends on the monomer concentration and…

Q: Plywood and particle board are often glued with cheap, waterproof urea-formaldehyde resins. Two to…

A: The structure of Urea formaldehyde is The resin can be prepared by reaction of urea with…

Q: Caterlarte the ৪वोधल्त फ्रील्वनक०nवकट ( जrाटक ड फोट PA vatue of कमा एर्चप्रर +54ल क० कल एदपा,छिमपल…

A: NaHCO3 ​  +    H2O →   H2CO3  +   NaOH                          Kb =  KaKb ​…

Q: Quien at noe 2 H₂0₂ (ar) → 2H₂0 (1) + 0₂ (g) Orien Laty [H₂0₂] M 1.22x10-2 8.04 x 10-3 5.30x10-3…

A:

Q: 4. NMR – Degree of Polymerization: Determine the DP (n = ?) using the 'H-NMR given below for…

A: The solution is given below:

Q: same for E1 reactivity.

A: For E2 mechanism, B alkyl halide is less Reactive to give elemination because it is 2° alkyl halide…

Q: C. PARAFFIN 1. Place a paraffin about the size of a rice grain in a dry test tube. Warm gently and…

A: Paraffin is a petroleum product. It is a highly branched saturated hydrocarbon of alkane class. So,…

Q: How is a sample of a polymer taken for characterization & analysis?

A:

Q: 1.Discuss the suitable initiator to start an addition polymerization.  2.Define what is…

A: Free radicals are used to initiate addition polymerization, organic and inorganic initiators can be…

Q: Show Saring Meriels 2.

A: Note: According to our guidelines we are supposed to answer only one question. Kindly repost other…

Q: Give five Synthetic Applications of Stobbe Condensation in detail?

A: The chemical reaction of an aldehyde or ketone with an ester of the succinic acid to produce…

Q: Show your work! 8. In an NMR study of a sample of polystyrene, it was determined that (mm) = 0.40…

A: When a molecular backbone contains all the substituents on same side then the molecule is called…

Q: Show the step-by-step process. Do not use shortcut methods. Make it as detailed as it can be.…

A: Chiral centre is that carbon which is attached to the four different groups. If any one group is…

Q: What hazards should you know about when you work with 6MHCl and 0.5M CuSO4?

A: (a) 6M HCI Pungent odour, strongly corrosive (dangerous) to body tissue. Protection respiratory…

Q: uots of 20-µl cell ly

A: To start experiment we should first have to know which equipment and glassware we need so that we…