Reset Help The protein appears to have regions that are closely associated with the region between the two |.It is likely in these regions of the protein are uniquely suited for binding (through nucleotide base pairs carboxyl groups of the DNA double helix, thus nestled against the that the amino acids weak interactions like and van der Waals forces) with specific nucleotide sugar-phosphate backbones sequences, thus recognizing them specifically. ionic bonds hydrogen bonds
Q: [S] Vo vo with I 0.00 0.00 0.00 1. 15 2. 14 0. 60 0. 25 0. 50 1. 15 2. 14 3. 75 6. 00 8. 57 1.00…
A: The plot is given in step 2
Q: (a) Lock and key model versus induced fit model of enzyme activity.
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 23. The following data describe the cleavage of peptide bonds in small peptides by the enzyme…
A: Introduction: Serine proteases are a large group of enzymes that cleaves the amide bond and…
Q: Biochemistry: Diagram the biosynthetic pathway from precursors (like amino acids, PRPP, etc.) to…
A: There are two pathways for the biosynthesis of nucleotides: de novo and the salvage pathways. In the…
Q: Indicate what step each of the events in the glycolysis pathway the following takes place: a.…
A: Glycolysis is a metabolism of glucose (six carbon molecule) into three carbon molecule (pyruvate)…
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: Which of the following is NOT true regarding nicotine? a. its psychoactive effects include…
A: Nicotine is a toxic substance present in tobacco. Nicotine is addictive and is hard to quit. It…
Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…
A: DNA replication being very complex process, there are chances of miss reading the DNA template and…
Q: Substrate A exhibits a Km toward a given enzyme of 11.32 mM, while substrate B exhibits a Km toward…
A: Km is the substrate concentration at which half Vmax. It is Michaelis menton constant which is used…
Q: Which of the following viruses have been used as vectors for gene delivery?
A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…
Q: HbA1c is used to monitor blood glucose levels because hemoglobin is the only protein in blood that…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: 4. As stated in your textbook, the first two reactions in glycolysis associated with unfavorable AG"…
A: The 2 reactions of concern here are the 6th and 9th reactions of glycolysis. Both these reactions…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: 4 types of color coding in biomedical and health care waste management
A: Health care waste is all the waste produced by a medical institution, a medical research facility,…
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: Coenzyme Q-10 (Ubiquinone) is one of the most important and crucial substances within the human…
A: Introduction: Coenzyme Q-10 is also known as ubiquinone or coenzyme Q. It is an oil-soluble and…
Q: Hypothesize ways to manage the disorders associated with the Inborn Errors of the Krebs Cycle. Given…
A: In the TCA cycle net gain of 6NADH molecule, 2FADH2 molecules by oxidative phosphorylation,…
Q: why all amino acids except glycine have L and D forms and specify the type of isomerization…
A: Amino acids are the monomeric units of proteins. The general structure of an amino acid has a…
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: A person with Down syndrome has one less chromosome than normal. Select one: a. False O b. True
A: Down syndrome: This is a genetic disorder associated with abnormal or delayed physical growth,…
Q: O The unknown sample contains tyrosine and tryptophan residues O The unknown sample only contains…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Why is DNA not RNA the storage for genetic information?
A: DNA : Deoxyribonucleic acid is a genetic material for the storage of information. The structure of…
Q: Describe why water is considered to be the most indispensable nutrient. Include a minimum of three…
A: A water molecule is made up of three atoms which include one oxygen and two hydrogen atoms. Most…
Q: Explain the mechanism of warburg effect and how it benefits cancer cells.
A: Warburg Effect or mechanism has been documented for over period of 90 years and extensively is being…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: Why is it necessary to study the diffusion of molecules in biological systems? (а.) To understand…
A: Diffusion is the process of random motion of molecules in which there is a net flow of matter from a…
Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…
A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…
Q: Draw the reactions and the interpretation on the lysine iron agar (lia) test for Proteus vulgaris
A: Proteus vulgaris is a gram negative, rod shaped facultative anaerobe in the Enterobacteriaceae…
Q: Which of the following processes generates the most ATP? (Account for the no. of ATP) a. ) Citric…
A: The human body is a complex system that requires energy to operate effectively. At the cellular…
Q: 8. Which of the following is commonly known as the Complex II of the electron transport system of…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: The laboratory requests of the physician are Glycosylated Hemoglobin and Serum Glucose for Mr. John…
A: Introduction: Glycosylated hemoglobin is a form of hemoglobin that is measured primarily to monitor…
Q: Proteomic analysis by mass spectrometry involves digestion of samples with to generate peptide…
A: Tandem mass spectrometry is a major technique for the peptide/protein sequencing and PTM analysis.
Q: How many number of histone proteins present in a nucleosome? 4 6 9.
A: The nucleosome is the basic structural unit of DNA packaging in eukaryotes and represents a segment…
Q: Is it somehow possible to generate carbohydrate from non-carbohydrate? If yes, how and if no, why?
A: Carbohydrates are organic molecules, which act as the primary source of energy. Glucose is the…
Q: What is the relationship between the cooling of organs and tissues for medical transplants and the…
A: For patients with end-stage disease, organ transplantation is the most effective therapy. Donor…
Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…
A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…
Q: CH,0-P-O C=0 0. CH;0-P-O CH,OH HO-C-H H-C-OH C-H Ö HO--H ČH,O-P-O- H-C-OH O t. CH;0-P-O
A: Glycolysis is a metabolic pathway of conversion to glucose to pyruvate.
Q: How many chromosomes are there in a body cell of a person with trisomy 21 condition? Select one: О…
A: Trisomy 21 is a genetic chromosomal disorder . Genetic chromosomal disorders are the diesese occurs…
Q: Morphine (give structure) and en receptor. How is that possible?
A: Antagonist are the drugs that plays an important role in blocking opiods without activating them by…
Q: List down the specific functions of the component structures of mitochondrion relative to cellular…
A: The mitochondrion is a membrane-bound organelle. It is called as powerhouse of the cell, it plays a…
Q: Which of the following statements are TRUE? Multiple answers:Multiple answers are accepted for…
A: The TCA cycle or tricarboxylic acid cycle is the second stage of cellular respiration. This is a…
Q: Glucose is a polar molecule. Would you predict that the amino acids of the enzyme hexokinase in the…
A: hexokinase catalyzes the transfer of the phosporyl group. The enzyme undergoes induced-fit…
Q: Reactions and Thermodynamics of Glycolysis
A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…
Q: Answer the ff. questions: 1. What factors influence the metabolic rate of citrate in the…
A: The acetyl group of acetyl CoA is bonded to a four-carbon oxaloacetate molecules to generate a…
Q: An Autosomal Dominant trait is only evident in the homozygous state. True False
A: A Dominant inheritance occurs when an abnormal gene from one parent is capable of causing disease.
Q: Briefly describe the following and give examples. 1. Monosaccharides 2. Disaccharides 3.…
A: 1. Monosaccharides - they are simple carbohydrates that consist of a single polyhydroxy aldehyde or…
Q: PTP1B Substrate kcat kca Km 10-7 x (8-1 м1) DADEPYLIPQQG DADAPYLIPQQG DAAEP YLIPQQG АAААpYLIPQQG…
A: Michaelis-Menten model of enzyme kinetics is a very useful model which describe the relationship…
Q: Proteomics analyses samples using electrophoresis and mass spectrometry. True False
A: Proteomic analysis which is also known as proteomics is referred as the branch in which the…
Q: do aklaloids minic neutrotransmitters in our bidy? amines contain: a) nitrogen atom b) an acid c)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 2. You want to clone a specific PCR amplicon. You have determined that the amplicon you want to…
A: pUC57 is a commonly used plasmid cloning vector in E. coli.
match.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGATDNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCCHN, NH. NH H2N° А. В. Consider the 3 structures shown. Which of these is (normally) NOT present in either DNA or RNA? (select all that apply) А В none of the above ZI C.
- Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are negatively charged (e.g., glutamateand aspartate), some are polar but uncharged, and some are nonpolar.If you knew that a DNA-binding protein was recognizingthe DNA backbone rather than a base sequence, which aminoacids in the protein would be good candidates for interacting withthe DNA?LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these amino acids.r this oligonucleotide, ● Classify if RNA or DNA? Justify your choice. determine the sequence of this segment, labeling the 5' and 3' ends. 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. Chargaff noted that the molar quantity of A was always approximately equal to the molar quantity of T, and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? O=P-OCH, O OH O=P- OCH, 0 O HN OH O=P-OCH₂ 0 NH NH₂ NH₂ 00 OH OH
- a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?The hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between eukaryotic cells. O Salt bridges form between oppositely charged histones and DNA in an aqueous environment. Nitrogenous bases are in the interior of the helix, when DNA is in an aqueous environment. Oil forms a homogenous mixture with polar solvents, like acetone.pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).One strand of DNA has the base sequence 5'-CATG-3' Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown: Label the sugar-phosphate backbone, the 5' and 3' ends of each strand, and the regions of hydrogen bonding.The top side of this figure offers more opportunities (for each base pair) that can lead to highly specific protein-DNA interactions. True or False? Major groove Major groove (a) Major groove Major groove O True N-HI110 O False A NIIH-N Minor groove Adenine-Thymine CH3 0111H-N H₂C OFITH 98 TN- GN-HIIN V-HillO Minor groove Guanine Cytosine Minor groove Thymine-Adenine Hillo C NIH OIH -NG Minor groove Cytosine Guanine