Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to explain WHY the answer is false Transcription factors are allowed to enter and exit the nuclease at all times.
Q: Sticky end ligation is generally preferred over blunt end ligation. Discuss one (1) scenario where…
A: Sticky end and blunt and ligation.
Q: Many noncoding RNAS take a complex stem and loop secondary structure. Which statement best describes…
A: RNA doesn't form any hydrogen bond or covalent bond between phosphate or nitrogenous base. So,…
Q: The gene provides instructions for making a protein called polycystin-2 Group of answer choices PKD2…
A: Introduction :- Polycystin-2 is thought to work as a channel in kidney cells, spanning the cell…
Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…
A: Aquatic Vertebrate is any newly hatched animal with a backbone or spinal column that spends the most…
Q: 10 13 ATLAS (coudal view) AXIS (left side) 16 CERVICAL (coudal view)
A:
Q: please help explain would SARS-CoV-2 N-nucleocasid protein be good target for neutralizing…
A: Severe acute respiratory syndrome (SARS)- coronavirus 2 (CoV-2) has caused the COVID-19 pandemic of…
Q: Which animals are at the top of the food chain?
A: Food chain : It is the chain which interconnects plants and animals through the energy consumption…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms Parenchyma is the tissue made up of cells and intercellular spaces that fills the interior…
Q: Label image attatched: Frog early cleavage
A: 1) and 2):fertilization membrane…
Q: • a DNA ladder with markers every 200 bp (DNA Ladder) • the resulting restriction fragments of the…
A: Restrictions endonuclease Restriction endonuclease are the enzymes which cleaves the DNA at the…
Q: You have an E.coli strain in which the lac operon is not expressed when glucose is absent and lacto…
A: The lactose operon (also known as the lac operon) is a group of genes present in E. coli and other…
Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…
A: DNA It is a nucleic acid which carries genetic information that gets passed from one generation to…
Q: 1. The recipient's of organ transplants can acquire some of the behavior and emotional traits of…
A: Neurons have been discovered in important organs like the heart, kidney, and liver. Transferred…
Q: bulk filter-feeding (baleen only) (not to scale) Pleist. 1.8 Pliocene 5.3 Late bulk filter-…
A: A small, new genus and species of toothed whale was recently named as Janjucetus hunderi, from the…
Q: The principal function for intestinal goblet cells is: Select one: t of a. secreting digestive…
A: Introduction :- Goblet cells are found throughout the small and large intestine and are crucial for…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Calico cats have tricolour coat. Their colouring is related to the X chromosome that's why they…
Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…
A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…
Q: Please give me a discussion/explanation of (INVITRO STUDIES AND INVIVO STUDIES) part in drug…
A: In vivo studies allow the long-term effects of the drug to be monitored and observed as well as…
Q: Finger pulse start of pulse upswing to peak (s) Total time (upswinging to baseline, s) 0.090 0.240
A: Introduction:- From the heart to the lungs, oxygen-rich blood is transported by the circulatory…
Q: 1. A long-haired homozygous black dachshund and a true-breeding (another word for homozygous)…
A: Introduction :- An organism is homozygous for a trait if it possesses two copies of the same allele,…
Q: Please explain how an intermediate filament is similar and different in a normal skin cell while in…
A: Answer :- As we know that the intermediate filaments involve the significant part of the…
Q: What are morphogens? Explain how they influence tissue patterning during embryonic development.…
A: In this question we have to describe about role of morphogen during embryogenic development simple…
Q: effect of increasing nucleocytoplasmic ratio during cleavage formation?
A: Cleavage Cleavage is defined as the embryological cell division. The resulting cells after cleavage…
Q: RECOMBINATION". For numbers 7-35, reler to the given data below. Glven the following testcross data…
A: Introduction "Genotype" refers to an organism's complete genetic information. The observed…
Q: A metabolic pathway can have unfavorable reactions within the pathway as long as the total sum of…
A: Introduction Metabolic pathway:- A metabolic pathway is a linked series of chemical reactions…
Q: Fats like lard and butter are solid at room temperature. What is it about the structures of their…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Spongy bone is found: in the periosteum in the ends of long bones O inside lacunae only in the fetal…
A:
Q: How do humans contribute to ocean acidification/decreasing ocean pH and what is the backfire of this…
A: Introduction :- The capture of carbon dioxide from the atmosphere causes ocean acidification, which…
Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…
Q: To determine: Whether landscape biology and restoration ecology are examples of in situ or ex situ…
A: The biological variety and variability of life on Earth is usually defined to stated as…
Q: thus, clonal expansion is The HIV attack the O Helper T cell / inhibited O Regulatory T cells /…
A: Answer :- Option (A) is correct. - Helper T cell / inhibited.
Q: What are the importance or benefits of preserving biodiversity? Please explain each
A: Biodiversity has contributed in many ways to the devolopment of human culture and inturn human…
Q: Label the parts of the avian skeleton
A: Aves Aves are the vertebrates group that includes birds. They evolved from reptiles. Some examples…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Parenchyma is the tissue made up of cells and intercellular spaces that fills the interior of the…
Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…
A: Introduction Proteins that operate as biological catalysts are known as enzymes. Chemical reactions…
Q: Results from mutations in one of several genes involved in the production of thyroid hormones. O…
A: Transcription factors are the proteins that bind to a specific DNA sequence. These are the proteins…
Q: The upper limbs are attached to the axial skeleton by the: O rib cage O pelvic girdle O pectoral…
A: All of the bones, cartilage, tendons, and joints in the human body make up the skeletal system. The…
Q: What do young herring gulls want when they peck the red spot on their parents' bills?
A: Pecking is a specialised behaviour in words suggesting that they need something. These birds are…
Q: Amari suspects they have a condition called metatarsalgia. This term is related to the term…
A: Introduction Metatarsalgia is a painful and inflammatory condition affecting the ball of your foot.…
Q: Why are multicellular organisms unable to reproduce through cell division?
A:
Q: What is molecular basis of muscle fatigue?
A: Introduction :- Muscle fatigue is a sign that your muscles' ability to perform is deteriorating with…
Q: The most common way that disease-causing bacteria harm the human body is by: causing high fevers…
A: Please follow step 2 for detailed explanation.
Q: When molecular biologists carry out a PCR, they have a range of different DNA polymerase enzymes on…
A: Polymerases α, δ, and ε are most active in dividing cells, suggesting that they function in…
Q: Hypercholesterolemia is caused by a defect on chromosome 19 and a mutation of LDL receptor. The…
A: Cholesterol Cholesterol is a fat-like waxy substance found in the blood which is necessary for our…
Q: Which of the following statements about bone marrow is CORRECT? yellow marrow is responsible for…
A: Bone marrow is the soft spongy tissue which contains blood vascle, found in centre of the bones.…
Q: Which is the smallest? O A. a human red blood cell O B. an E. coli cell O C. the influenza virus O…
A: The size of microbes is often defined as tiny. As a result, they are invisible to the naked sight.…
Q: Heart muscle works hard and therefore consumes much ATP. Which organelles would you expect to be…
A: Heart muscle or cardiac muscle signifies the thick middle layer of heart, which is known as…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Introduction Stem cells:- They serve as a repair system for the body because these are the cells…
Q: Determine what is the most likely mode of inheritance of this disease (whether it is inherited as…
A: Inheritance pattern is a pattern tat evaluates how traits are transmitted from parent generation to…
Q: Homo is a recently discovered hominin found in southeast Asia. Current evidence suggest that it may…
A: hominin, any member of the zoological “tribe” Hominini of which only one species exists today—Homo…
Step by step
Solved in 2 steps
- To be considered a transcription factor, a protein must bind the DNA. True or FalseMutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC
- Please complete the strand code chart. Thanks!cDNA labeled with Cy5 dye-Red cDNA labeled with Cy3 dye-GreenConcept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::
- State whether TRUE or FALSE. Explain your answer Reverse transcription occurs naturally in the human body.Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to explain WHY the answer is false. Proteins that were made to be sorted OUT of the endoplasmid reticulum (ER) do NOT have a retention signal so that the protein can leave the ER.Write if TRUE/FALSE. mRNA splicing takes place in bacteria. In eukaryotes, replication and transcription takes place in the nucleus. Sigma subunit guides the RNA polymerase to locate the promoter region in RNA. The direction of synthesis of DNA and RNA is the same, from 5’→3’ direction. The Okazaki fragment forms when the synthesis of the DNA strand runs toward the replication fork.