QUESTION 4 Goldberger's direct research contributions leading to identification and replacement of the P-P factor (pellagra preventive factor), the missing dietary element associated with pellagra, included all of the following, except? He studied a pellagra analog disease in laboratory dogs by feeding them a corn-rich diet. He supplemented a corn-rich diet with brewer's yeast in dogs and then in humans to support that brewer's yeast provided the p-p factor. He oversaw the distribution of tens of thousands of pounds of brewer's yeast to flooded areas of the south to successfully treat populations suffering from pellagra. He identified niacin (abundant in brewer's yeast) as the elusive P-P factor. He established a standard dosage and therapy for niacin.

QUESTION 4 Goldberger's direct research contributions leading to identification and replacement of the P-P factor (pellagra preventive factor), the missing dietary element associated with pellagra, included all of the following, except? He studied a pellagra analog disease in laboratory dogs by feeding them a corn-rich diet. He supplemented a corn-rich diet with brewer's yeast in dogs and then in humans to support that brewer's yeast provided the p-p factor. He oversaw the distribution of tens of thousands of pounds of brewer's yeast to flooded areas of the south to successfully treat populations suffering from pellagra. He identified niacin (abundant in brewer's yeast) as the elusive P-P factor. He established a standard dosage and therapy for niacin.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
QUESTION 8 Consider the pathway for the synthesis of the amino acid arginine in Neurospora: ARG-E → citrulline ARG-F ARG-H ornithine argininosuccinate arginine Mutant strains of Neurospora may carry one or more mutations. Neurospora mutant strain b is grown on minimal media plus supplements as shown. Growth is shown by (+) and no growth is shown by (o). Supplements ornithine mutant nothing citrulline arginino- succinate arginine strain What can you conclude from these data? O Strain a has only one mutation and it is in ARG-E. O Strain b has only one mutation and it is in ARG-H. O Strain a has a mutation in ARG-F and strain b has a mutation in ARG-E. O Strain b has mutations in ARG-E, ARG-F, and ARG-H. + +
Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCOCTACGTGATAG...3' promoter A) Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'
Question 15 How did you select and grow a streptomycin resistant strain of bacteria in this experiment? 1. A sample of bacteria was exposed to streptomycin by inoculating it onto a streptomycin negative plate. Colonies that grew carried a mutation for resistance 2. A colony of bacteria was with streptomycin so that the antibiotic could alter then genetic composition of the bacteria . 3. A sample of bacteria was exposed to streptomycin by inoculating it onto a streptomycin positive plate. Colonies that grew carried a mutation for resistance
Question 15 How did you select and grow a streptomycin resistant strain of bacteria in this experiment? 1. A sample of bacteria was exposed to streptomycin by inoculating it onto a streptomycin negative plate. Colonies that grew carried a mutation for resistance 2. A colony of bacteria was with streptomycin so that the antibiotic could alter then genetic composition of the bacteria . 3. A sample of bacteria was exposed to streptomycin by inoculating it onto a streptomycin positive plate. Colonies that grew carried a mutation for resistance 4. Samples of bacteria were taken from the culture and observed under a microscope for signs of susceptibility or resistance . Those that were resistant were separated and plated .
Question 10: What does the presence of the prototrophic strain "control" for? In other words, what was its purpose in the experiment? O To ensure that the UMM basic medium can support growth and to give an indication of what growth on such a medium should look like. O To ensure that the control strain will grow in a rich environment which will give an idea of what mutant strains will look like on an UMM basic environment. O To see if all other strains will grow in a rich environment. There is no reason other than curiosity. O To see if the control strain is prototrophic.
Need help Sesamin is one of the major lignans found in sesame oil. Sesamin-metabolic pathways remain uncharacterized at both the enzyme and gene levels. However, one microorganism showed significant sesamin-degrading activity and was identified as Sinomonas sp. no. 22. A sesamin- metabolizing enzyme named SesA was purified from this strain and characterized. Explain how sesamin methylene transferase was identified and characterized and explain the mechanism. Based on your knowledge, what other assays could be run to characterize this enzyme?
mtDNA depletion syndrome 13 is a rare genetic disorder, in which individuals have fewer mitochondria in the muscles than normal because the organelles are degraded by lysosomes. Would this disorder impact the muscles' ability to perform the Cori Cycle? O Yes, it would interfere with lactic acid fermentation. O Yes, it would interfere with aerobic gluconeogenesis. O Yes, it would interfere with anaerobic glycolysis. O No, it would not impact the Cori Cycle.
Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…
Question 9 What is the most likely reason that there were so few bacterial colonies growing on the streptomycin-positive plate in the first part of the experiment? 1. Streptomycin in the medium caused deleterious mutations in the bacteria. 2. Only a few individuals in the original bacterial culture had the mutation that conferred resistance to streptomycin .
Cytokine Storm (Cytokine Storm) COVID-19The high mortality rate in COVID-19 patients is caused by the occurrence of a cytokine storm (cytokine storm) in the patient's body. This is based on research supported by data obtained, among others, from laboratory results; that there was a significant difference between patients who recovered and those who died. What research data? Please Answer these following structured questions; Are cytokines a protein? How many amino acid residues of human cytokines? The sequence of the amino acid residues? Accession number at GenBank ? Determine the mRNA sequence Determine the coding sequence Define the sequence template What is a Cytokine storm What research data support the occurrence of Cytokine storm in humans Answers on paper with source cited provided will be helpful since im new in this part and want to learn from the source you find the answer Thank you
PDB code 7BSJ Questions Q1 - What is the name of the protein Q2 - What does the protein do? Q3 - What are the structural features of the protein? Q4 - What are two features of your protein’s structure that make it different OR similar to haemoglobin? Q5 - Based on the structural properties of your protein, how resistant (or sensitive) would your protein be to heat denaturation and why?