Q: Which of the following media is capable of detecting all clinically significant antibodies while…
A: The question is asking us to identify the medium that can detect all clinically significant…
Q: 5. What tip should be used when assisting a person with Alzheimer’s disease with eating? Know the…
A: Detailed explanation:When aiding people with Alzheimer's disease during mealtimes, it is critical to…
Q: Why was the Cambrian era most unique among the fossil record of animal evolution? O Soft bodied…
A: "Soft-bodied animals fossilized only in this era": This option is incorrectWhile soft-bodied animals…
Q: How many protons are present in the atomic nucleus of nitrogen (based on the atomic number)? A. 7…
A: The number of protons in an atom is determined by its atomic number. The atomic number is unique to…
Q: THINK ABOUT IT- Look at the food web below and answer the questions. FIGURE 6.3 Food webs: (a) a…
A: Food webs show intricate relationships that sustain life within various ecosystems, showcasing the…
Q: 6. To be considered national origin harassment, which of the following statements is correct? The…
A: The harassment victim's native language must not be English. - This statement is incorrect. National…
Q: True or false: Vertebrates are taxonomically more diverse than invertebrates
A: 1. Understanding Taxonomy: - Taxonomy is the science of classifying organisms into different groups…
Q: Pick a theory/concept involving biomechanics and discuss how you can apply it when having a job as a…
A: a) Which biomechanical theory is used?In the realm of physical therapy, one of the foundational…
Q: = Q Set up Bacteria Growth Experiment 2024 Saved Search Design Layout References Mailings Review…
A: Here's a comprehensive discussion on how to set up such an experiment: 1. Define the Objective:…
Q: Which of the following is a concern of in-vivo gene therapy? A. Lytic vector expression B.…
A: C. Immune response to viral vector: This is a major concern with in-vivo gene therapy. Viral vectors…
Q: What types of biological evidence would you need to look at to determine how closely related…
A: The objective of the question is to identify the types of biological evidence that can be used to…
Q: Question 15 Which of the following statements is NOT true about GWAS? O When identifying alleles…
A: Detailed explanation:1) a) When identifying alleles associated with a disease, we compare the…
Q: Can stress be addictive, when looking at the positive and negative effects of stress on the human…
A: The answer delves into the nuanced concept of stress as potentially addictive, examining both its…
Q: One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…
A: To determine the size of the CACNA1S transcript named CACNA1S-202 in terms of amino acid residues,…
Q: 24. The diagram below shows the map for EcoRI restriction sites around the BRCA1 gene for two…
A: Answer well explained above.
Q: Enzymes are not used up in chemical reactions, so what exactly does an enzyme do? Refer to…
A: Here's a breakdown of what enzymes do in terms of activation energy and transition state…
Q: Describe the progression of cancer from an early benign lesion to a genetically heterogeneous…
A: Title: Understanding the Progression of Cancer and Its Implications for Antineoplastic…
Q: What are the functions of the repeats, the spacers and the Cas9 enzyme?
A: The question is asking about the functions of three key components of the CRISPR-Cas9 system, which…
Q: Which of these statements about bacteria are true? All of these are true Some of can breath metals…
A: The objective of the question is to verify the truthfulness of the given statements about bacteria.
Q: Based on the information provided by the Angus pedigree below, Princess Alta of Wey (R) is inbred. T…
A: Inbreeding occurs when an animal's parents are more related than the average individual in the…
Q: The adaptation planning process draws on broad principles of the ecosystem approach to fisheries…
A: The objective of the question is to identify which of the given options are not balanced through…
Q: Question 14 One of the two genes known to be mutated in cases of Hypokalemic periodic…
A: I used the Ensembl database, which offers comprehensive information about gene sequences, including…
Q: Do you think the current conversation about abortion makes good arguments? If so, what is…
A: I hope these suggestions and recommendations help you with your assigned tasks. Have a great day…
Q: Please explain this. Below is the payoff matrix for a two-player-two-move game. If…
A: ConceptThe Prisoner's Dilemma in game theory is where two rational individuals might not cooperate,…
Q: Tarsiers have been reclassified into which suborder of primates: A) strepirrhini B) Lemurs C)…
A: The question is asking to identify the suborder of primates into which Tarsiers have been…
Q: What is the simplest way to solve this? Please give me a step by step explanation.
A: Approach to solving the question:Detailed explanation: Note: 10×10−2=101−2=10−1…
Q: A common factor associated with all past and even current mass extinction events is... O Meteorite…
A: -Rapid changes in global environmental circumstances, such as abrupt temperature change or changes…
Q: O Off target effects are not really a concern. Question 20 What happens after a double stranded…
A: When a double-stranded break occurs in DNA, cells have several mechanisms to repair the damage.…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of this question is to understand the pathophysiology of an Upper Respiratory Tract…
Q: ory X Gakg614 micro x Mail - Kayli Je X Google Docs × <for X Xavier Univer x…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: Briefly discuss the effects of screen use in children
A: Approach to solving the question: To address the effects of screen use in children comprehensively,…
Q: Urgently needed
A: A) Allele FrequenciesTotal Rabbits (N) = 150Homozygous Dominant (WW) = 100Heterozygous (Ww) =…
Q: You have a friend with a child whose growth is slightly below average. They would like to know about…
A: What Happens If You Take HGH?Human Growth Hormone (HGH), also known as somatotropin, is a naturally…
Q: Given that the extracellular concentration of Cl- is approximately 120 mM, what is the intracellular…
A:
Q: Marasmus is associated with ____. a. changes in skin and hair pigmentation b.…
A: The question is asking to identify the symptom that is associated with Marasmus, a severe form of…
Q: Reasons why PCR for two out of the three constructs (His-TAQ, TAQ-His, and His-TAQ-His) would not…
A: To help you understand the answer above, here is a less technical explanation of it:Imagine you have…
Q: Regarding optic ataxia, what is its clinical etiology, symptoms, and treatments. What are the…
A: Etiology (Causes)Brain Regions Involved:• Parietal Lobe: This region integrates visual and motor…
Q: The question is:
A: Approach to solving the question: I hope this helps!! Detailed explanation: Examples: Key…
Q: What are the subsectors of the fisheries and aquaculture sector? Select two or more:…
A: The question is asking to identify the subsectors of the fisheries and aquaculture sector. The…
Q: Drag and drop from the available list of terms. Anabolic reactions are type of reaction. In these…
A: The building of complex molecules, such as sugars, from simpler ones is an anabolic process and is…
Q: help
A: Answer 3True. Some food allergies do have a genetic component. People with a family history of…
Q: Draw the peptide Glycine-Alanine-Serine-Cysteine-Isoleucine-Glutamic acid Tryptophan-Valine. Circle…
A: To explain in more detail, let's delve deeper into the structure and bonding of the peptide…
Q: Describe the action potential conduction and neurotransmission process from one neuron to another,…
A: Key references:Chen I, Lui F. Neuroanatomy, Neuron Action Potential. [Updated 2023 Aug 14]. In:…
Q: State the percentage range of the fresh weight of animals that is made up of water, and situate…
A: The objective of the question is to understand the percentage of water that makes up the fresh…
Q: Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of…
A: Step 1: The order of the steps required to sequence a region of DNA using dideoxy sequencing…
Q: You are studying a protein-protein interaction in 2 proteins. You decide to test both these proteins…
A: Approach to solving the question:Disulfide bonds unlikely:Disulfide bonds are probably broken by the…
Q: About adaptation planning, which of the following sentences are true? Select two or more: An…
A: The objective of the question is to identify the correct statements about adaptation planning from…
Q: What are IPS cells? Give an application?
A: Induced Pluripotent Stem (IPS) cells are a type of pluripotent stem cell that can be generated…
Q: Each of the three different Hfr strains in the table below (A, B and C) arose independently and…
A: A genome is the complete set of genetic information in an organism. It provides all of the…
Q: Anne had the smallpox virus. She is unlikely to get sick if she is infected with the smallpox virus…
A: The question is asking whether Anne, who has previously been infected with the smallpox virus and…
Genetics Q3
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short AnswerQuestion 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCGATATAAGTGCACCATGCGAT 5' Start site Short Answer 140QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…
- Question 4 "In this mutation, the AGC is transcribed into UAG. " O missense mutation O nonsense mutation O silent mutation O frameshift mutationQuestion 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune response against viral infection O a molecule involved in regulation of expression Oan enzyme complex involved in homologous recombination O bacterial conjugation system Question 19 Which of the following is FALSE in relation to CRISPR/Cas9? O Cas9 needs a PAM site consisting of an NGG sequence. Cas9 will malQuestion 3 Bacteria defend against phages by Natural selection favors mutation can not be recognized by virus. O all of these except DNA replication O restriction enzymes CRISPR-Cas system O DNA replication
- QUESTION 10 Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are marked with an arrow. THe length of each part is marked with base sunderneath. What is the size of the protein made? Teminator Promoter7 Gene (DNA) AUG UAA Exon 1 Exon 2 Exon 3 Exon 4 Intron 15 Intron 2 17 Intron 3 14 15 27 30 27 30 30 O 37 amino acids O 114 amino acids O 53 amino acids 68 amino acidsQuestion 32 What is the difference between an operator and a promoter? Edit View Insert Format Tools Table 12pt v Paragraph v B IUA 2 T?v T²Question 2 "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." O missense mutation nonsense mutation O silent mutation O frameshift mutation
- QUESTION 14 What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence immediately downstream of your target site. What happens? O It's fine because you put the PAM sequence in your guide RNA O PAM sequences only apply to real viral infections, not CRISPR assays. O The Cas9 nuclease won't cut at the target site O The guide RNA won't be complementary to the target O They'll be more off target effects but it'll still work.Question 8 The cloning a eukaryotic gene in a bacterial plasmid does not include extension gene inserted into a cloning vector such as a plasmid The vector is obtained by bacterial cells. O Host cells grown in culture to form a clone of cells containing the "cloned gene of interest" O formation of a recombinant DNAQuestion 5 If an mRNA has the sequence 5'--AUGGUGUUA--3' what is the sequence of the coding DNA strand? Please input just the letters with no other marks. ATGGTGTTA 1 pts