Question 14 Short regions of chromosome 1 were sequenced in a population of C. elegans. These sequences from three different flies are shown below. Identify the SNP haplotype for Worm #3. N = any nucleotide. Worm #1: 5' ATGGCACGAAGCTAAGAATA 3' Worm #2: 5' ATGGCTCGACGCTCATAATA 3' Worm #3: 5' ATGGCGCGATGCTAAGAATC 3'

Q: QUESTION 13 Part of the sequence of a prokaryotic gene, including the translational start site, is…

A: DNA is a double helical structure with two helices bounded to each other. One strand is template and…

Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…

A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…

Q: QUESTION 22 Mst digeston Hb*I Hb HDI HD Hb*I Hb E 1.35 kb E 1.16 kb Southern blot The figure above…

A: As indicated in the RFLP and restriction digestion analysis of the HbA and HbS gene there is a…

Q: Question 8 Electrophoresis in agarose gel A The DNA will migrate to the negative elec- trode due to…

A: Agarose gel electrophoresis is a commonly used laboratory technique to separate the charged…

Q: QUESTION 31 Written from 5' to 3', the sequence of an RNA molecule made using the top strand of DNA…

A: INTRODUCTION Transcription is the process of making an RNA copy of a gene sequence. This copy,…

Q: QUESTION 21 You have the following coding sequence for a gene and need to generate billions of…

A: Polymerase chain reaction (PCR) is a fast in vitro method to amplify a given DNA sequence present in…

Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…

A: Answer- Option D. 5' TAGTGACAGTTGCGAT 3¹

Q: Question 21 Your research team has been tasked with using a variety of horizontal gene transfer…

A: This question is about prokaryotic dna replication

Q: Question 14: You examined 8 mutants, so in theory there could be 8 complementation groups…

A:

Q: Question 8 Modification of histone proteins include the following EXCEPT A phosphorylation of serine…

A: Histones are highly basic proteins that compress DNA within the nucleus to produce chromatin, which…

Q: Question 5 To identify genes associated with the movement disorder Parkinson's disease, you decide…

A: Inorder to amplify a double stranded DNA via PCR, we require 2 sets of primer; a forward primer and…

Q: Question 11 Species A and species B have the following nucleotide sequence at a locus that is not…

A: Genetic divergence is defined as the process that occurs through the accumulation of mutations in…

Q: QUESTION NO. 1  Fragile X syndrome is a common form of inherited mental retardation. The mutation in…

A: Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: Question 8 The unique stem-loop structures of the transfer RNA helps the RNA perform its function of…

A: tRNA (Transfer ribonucleic acid) is one type of RNA that is used in translation machineri to decode…

Q: Question 15 The cap on an mRNA O is located on the 3' end of the molecule O is long chain of As on…

A: In humans and other eukaryotes, a freshly made RNA transcript is not quite ready to go. Instead it…

Q: Question 14: You examined 8 mutants, so in theory there could be 8 complementation groups…

A: The analysis has been done in a tabular manner and the growth is represented by black dots. Here…

Q: Question 22 Af the percentage of adenine in a given sample of DNA is 20%, then the ercentage of…

A: Chargaff's rule: He studied the base composition  of DNA on variety of sources and proposed the…

Q: Question 36 DNA molecules can perform their function in replication and transcription as long as the…

A: Yes its a true statement . The hydrogen bonds between the bases of the DNA provides the…

Q: Question 6 The helical turns of the DNA does not only provide spaces for binding with regulatory…

A: Introduction: RNA and DNA are the two types of nucleic acids. The nucleic acid serves as a…

Q: Question 22 Cloning vector contains a multiple cloning site (MCS) or polylinker containing multiple…

A: Vectors are agents or organisms that transfer genetic material or infectious elements from one…

Q: Question 14 If Guanine is 30% of the total bases in a dsDNA, the thymine content is 40%. A True B…

A: Charging rule states that the adenine and thymime would be equal and the cytosine and guanine would…

Q: QUESTION 5 the heteroduplex region is a region that O any DNA that is double stranded O DNA contains…

A: Introduction: Recombination is the process in which there occurs physical exchange of the sequence…

Q: QUESTION 18 An example of Directional Selection is: O 1. Choosing "ANTH 1200" as a the highest…

A: In population genetics, directional selection is a sort of negative natural selection in which an…

Q: The symbol for a normal human male is 46, XY. Write the symbols for: A male with Down Syndrome.…

A: Down syndrome  Down syndrome is a genetic disorder that has an extra copy of chromosome.    Deletion…

Q: Question 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and…

A: Tests that may help diagnose Friedreich's ataxia include nerve conduction studies, tests of heart…

Q: QUESTION 21 Consider the following template strand of DNA: AAT TCA CCC 3' 5 The mRNA made from this…

A: DNA stands for Deoxy-ribonucleic acid. It is a molecule which carries the information of a proteins.…

Q: Question 6 the following DNA strand 5'-AACGATCATAT- 3' is: The complementary strand of |A…

A: Double stranded DNA is complementary to each other. This complementarity is governed by…

Q: QUESTION 29 In samples of DNA, isolated from two unidentified species of bacteria X and Y, adenine…

A: According to Chargaff's rule that the amount of purine should be equal to pyrimidine and also that…

Q: Question 11 In a molecule of double-stranded DNA, the amount of Adenine present is always equal to…

A: DNA is a double stranded helical structure comprised of several nucleotides joined end to end.…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: QUESTION 15 The genome stze of humans and chimpanzees are both approximately 3 bilion base pairs,…

A: As per our guidelines, we are supposed to answer only one question. Kindly repost other questions as…

Q: QUESTION 22 Ribosomal RNA: O a. none of the above O b. acts only as a structural scaffold O C.…

A: The cell exhibits genetic material in the form of DNA as well as RNA.

Q: QUESTION 13 The two strands of a DNA molecule are held together by hydrogen bonds between the O…

A: DNA is a genetic material, which contains all the information.

Q: QUESTION 37 When treated wth AZT, a population of HIV wil inevitably evolve trom aimost all…

A: The enzyme reverse transcriptase (RT) catalyses reverse transcription of the viral RNA genome into…

Q: Question 21 Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the…

A: Transcription is the process that occurs in nucleus of a cell that involves the Synthesis of mRNA…

Q: Question 41 The helical turns of the DNA does not only provide spaces for binding with regulatory…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two nucleotide bases that coil around one…

Q: Question 38 The 2 chains composing one double helix run in opposite directions; they are…

A: Yes its a true statement , the two strainds of the double stranded DNA runs in the antiparallel…

Q: Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie…

A: PNA peptide nucleic acid is the artificial Nucleic acid structurally similar to nucleic acid.

Q: During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________.…

A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…

Q: QUESTION 5 In the Sanger method of DNA sequencing, if a dideoxynucleotide is attached, a…

A: Introduction:- The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…

Q: Question 36 Most eukaryotic RNA consists of coding regions, called and noncoding regions, called A…

A: INTRODUCTION Answer to the question 36 is given below.

Q: Question 5 Eukaryotic transcription regulators can control transcription initiation away from the…

A: Transcription is the process of RNA production from the DNA template that occurs within the nucleus…

Q: PCR is a technique that:     produces information regarding the sequence of nitrogenous bases…

A: Kary Mullis discovered the PCR technique. PCR stands for polymerase chain reaction.

Q: QUESTION 4 The two strands of DNA that make up a single molecule are oriented to each other.…

A: Watson and Crick elucidated the structure of a DNA molecule . They performed X ray analysis of the…

Q: QUESTION 12 Ack! Your nematode cultures are infested with a pesky, but novel bacterium! You decide…

A: Speciation is the process through which one genetically related population splits into two…

Q: Question 5 DNA polymerase: A Is able to open the helix at the origin of replication. B Works on both…

A: Introduction: The process in which the strands of DNA synthesizes the new strand of DNA with the…

Q: QUESTION 36 DNA is tightly coiled around proteins (histones) that resemble a bead-like structure…

A: For the answer to the second part of the question, please post it separately. Thank you. DNA is a…

Q: Question 21 There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the…

A: There are three stop codons which stops the process of the translation and the protein synthesis get…

Q: Human immunodeficiency virus (HIV) is of interest to evolutionary biologists because all of the…

A: The study of evolutionary genetics is essential as it traces the reasons for many unanswered…

Q: QUESTION 13 RNA is pretty easy to make into DNA because it's single stranded, doesn't form as many…

A: RNA or ribonucleic acid is a complex compound of high atomic weight that capacities in cell protein…

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.