Q10 What would happen if DNA polymerase III encountered the nucleoside triphosphate on the right? -O-CH, H C. It would be added to the growing DNA strand and would also allow the next nucleotide to be added. Н NH₂ A. It would not be added to the growing DNA strand. B. It would be added to the growing DNA strand but would not allow the next nucleotide to be added to it. D. It could be added to the growing DNA strand and would allow the next nucleotide to be added to it, but it would have to be replaced by upstream DNA synthesis. E. It would immediately stall Pol III before being added to the growing DNA strand.

Q10 What would happen if DNA polymerase III encountered the nucleoside triphosphate on the right? -O-CH, H C. It would be added to the growing DNA strand and would also allow the next nucleotide to be added. Н NH₂ A. It would not be added to the growing DNA strand. B. It would be added to the growing DNA strand but would not allow the next nucleotide to be added to it. D. It could be added to the growing DNA strand and would allow the next nucleotide to be added to it, but it would have to be replaced by upstream DNA synthesis. E. It would immediately stall Pol III before being added to the growing DNA strand.

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2CT: Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so...

See similar textbooks

Similar questions

What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. D. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.
You are characterizing a new DNA polymerase. In a test tube, you incubate the enzyme with all the components needed for catalysis, EXCEPT you don't add any dNTPs. However, you notice that some type of catalysis has occurred. What is the most likely product in this case? O The supercoils in the DNA have been relieved O The sugar has been converted from a deoxyribose to a ribose A DNA strand is one base shorter due to nuclease activity The magnesium ion has been converted to a charge of +2 to +1
a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
nd 2 minutes): Any RNA polymerase in any organism: O A Synthesizes RNA chains in the 3 to-5" direction O B. Binds tightly to a reqion of DNA located thousands of base pairs away from the transcobed rogion of the DNA OC Has proofreading activity O D. Separates DNA strands throughout a long region of DNA (up to tinousands of base pairs) and then copies one of them. OE Has a subunit called A (lambda), which acts as a proofreading ribonuclease OF. Can initiate synthesis of a new RNA chain without a primer
It is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA becauseotherwise which of the following events would result?a. The RNA would interfere with topoisomerasefunction.b. The RNA would be more likely to contain errorsbecause primase lacks a proofreading function.c. The β-clamp of the DNA pol II dimer would releasethe DNA and replication would stop.d. The RNA primers would be likely to hydrogen bondto each other, forming complex structures that mightinterfere with the proper formation of the DNA helix
2. For each DNA repair process in column I, list all characteristics from column II that correctly describe that process. I II 1. RecA protein participates. 2. Damaged nucleotides are removed by nick translation (a) Nucleotide excision repair (b) Photoreactivation (c) Base excision repair (d) Recombinational repair (e) SOS-driven error-prone repair (f) Alkyltransferase repair (g) Mismatch repair (h) Double-strand break repair 3. A free radical mechanism is involved. 4. The repair enzyme functions only once. 5. The key enzyme contains a bound folate cofactor. 6. No bases or nucleotides are removed from the DNA. 7. Deficiency of this enzyme in humans greatly increases the risk of skin cancer. 8. This system is chiefly responsible for the mutagenic effect of ultraviolet light. 9. The first enzyme in this pathway cleaves two phosphodiester bonds. 10. This process begins up to 1 kbp away from the site to be repaired. 11. DNA ligase catalyzes the final reaction. 12. This process also occurs…
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
23. What process best describes the action of Taq DNA polymerase? a. Catalyzes hydrolysis of phosphodiester bond b. Catalyzes an oxidation-reduction reaction c. Catalyzes the formation of a phosphodiester bond
The function of gamma (y) complex of DNA polymerase III is to Select one: O a. to unwind double strand DNA (template DNA). O b. to associate the core DNA polymerase llI with template DNA. O c. to stimulate 5' to 3' exonuclease activity O d. to upload beta subunit of DNA polymerase III to template DNA.
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5'.atacaATGcATGTCAaCTAcgaagatccgTAGaTAACATtCATatc...3' a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5' and 3' ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends. c. Translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the underlined, bold a were mutated to be a t. Write the new sequence of your mRNA…
.. CTGATTCCGAA TG5 ACTIVITY 7.3.1 Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. .GACTAAGGCTTAG . CTGATICCGAATGS 5'... NEW STRANDS (Fill in the correct bases and supply arrowheads.)