pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the double digest produces 4 fragments, with only 3 sizes what is the largest fragment size? 3.0kb 4.0kb 2.0kb 8.0kb

pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the double digest produces 4 fragments, with only 3 sizes what is the largest fragment size? 3.0kb 4.0kb 2.0kb 8.0kb

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: When an inappropriate amino acid is substituted in place of another, as occurs in certain genetic…

A: Though proteins are made up of hundreds of amino acids but each amino acid is important in the…

Q: The following peptide is cut by serine protease enzyme Trypsin. How many fragments will be produced…

A: Proteases are enzymes which digest proteins by cleaving the peptide bonds. Trypsin is a protease…

Q: 1. The DNA strand which is mostly like to form DNA Z DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: Reaction mechanism of proteins, lipids, carbohydrates, nucleic acids

A: Proteins, nucleic acids, lipids and carbohydrates are frequently found in nature as lengthy…

Q: Now consider three sugars-glucose, glucuronic acid, and N-acetylglucosamine. Use shorthand (e.g.,…

A: A glycosidic bond is formed between 2 carbon atoms as the result of a dehydration reaction. The…

Q: Which of the following is likely to be correct if all mutases are completely inhibited? a. Removal…

A: Mutases are the Enzymes that catalyse the transfer of functional groups from one position to other…

Q: The following has the lowest energy per gram when oxidized Carbohydrate protein O ethanol O Lipids O

A: Nutrients are the compounds that provide us energy when they are oxidised. These nutrients like…

Q: Our body can get pentoses from * O (A) Glycolytic pathway O (B) Uromic acid pathway O (C) TCA cycle…

Q: Dihydrofolate reductase (DHFR) is an enzyme that reduces 7,8-dihydrofolate (DHF) to 5,6,7,8-…

A: To solve this question, we need to plot the LB Plot. The LB Plot has 1[S0] as X-axis and 1V0 as…

Q: Which statement(s) regarding ions is true when a neuron is at rest? Positively charged cations are…

A: Neurons are also known by the name nerve cells. These cells are referred to as the fundamental units…

Q: Describe the importance of Wee1, Myt1, CAK and cdc25 activity on the activation of the cyclin B/CDK1…

A: CDKs are the proteins whose concentration increases or decreases during the cell cycle. The…

Q: The enzyme that involved in the catalysis from alpha-ketoglutarate to glutamate is A.…

A: The enzyme that involved in the catalysis from alpha-ketoglutarate to glutamate is.......

Q: True or false: if all mutates are inhibited removal of glucosyl residues from nonreducing ends of…

A: A highly branched glucose polymer known as glycogen is utilized by animals as a form of energy. It's…

Q: Which of the following statements are descriptions of metal ion catalysis or examples of metal ion…

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…

Q: What chemical group is found at the 5' end of a *?polynucleotide chain

A: Polynucleotide: The Linear polymer composed of- the many nucleotide units.

Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…

A: DNA isolation is a process of isolation of DNA from biological sample like body fluid, tissue, etc.…

Q: Mach the terms left with as many terms. GMP Nucleotide FAD AMP TCA D-loop Helical Shape Nucleosome…

A: Nucleic acids are also called polynucleotides. They are made up of nucleotides. Two types of nucleic…

Q: Explain why vegetable oil and water don't dissolve in one another.

A: Lipids are non-polar biomolecules composed of fatty acids and an alcohol. Some of the lipids have…

Q: You wish to perform an electrophoretic resolution of your restriction enzyme–digested DNA. The sizes…

A: [All questions belong to 4 different topics. We are supposed to solve only one question in detail in…

Q: Peptide 1: Peptide 2: NH₂ H₂N pro-ile-glu-arg N OH OH OH OH

Q: The hydrolysis of nucleoside triphosphates A. is required for them to act as regulatory molecules.…

A: Hydrolysis of Nucleoside Triphosphate involves cleaving of beta- gamma Phospho diester bond in the…

Q: 3-day -old female newborn with a deficiency of mitochondrial carbamoyl phosphate synthetase develops…

A: Carbamoyl phosphate synthetase is an enzyme which catalyzes the first reaction of the urea cycle.…

Q: The mu receptor is directly activated by: O morphine O methamphetamine O nicotine O LSD

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: write true if the statement if correct and change the bold word/phrase to make it correct lower…

A: Glycogen is the storage form of carbohydrates in animals. It is also called animal starch for this…

Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…

A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…

Q: The fundamental cause of sickle-cell disease is a change in the structure of: a. blood. b.…

A: Sickle cell disease - Inherited blood disorder, red blood cells are shaped like sickle .

Q: What would the tertiary structure of the dipeptide Asp-Ser be if it was made into a polypeptide…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Which of the following is true about the T (tense) -->R (relaxed) transition of hemoglobin? A. The…

A: Haemoglobin is described as a very important protein that is present in our RBCs. They have the role…

Q: 20. Which one of the following sentences concerning amino acids, which provide functional groups…

A: The region in an enzyme responsible for undertaking catalysis is called the active site. The…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma which said that the DNA is replicated and the process of…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: 1. Dehydrogenase with H₂N-KKRRRPRPKPAPASAMEWANTWENTY...-COOH a. Provide the amino acid sequence of…

A: The signal peptide have a significant role in protein targeting and protein translocation in both…

Q: Which of the following compounds is not a TRUE ketone body? Acetoacetate All options are correct.…

A: To generate energy ketone bodies are used by cardiac and skeletal tissues. In starvation…

Q: 7.0, each into e 2 in ne ding 1. Du kan 8 10 6 itions. TABLE 2 Effect of pH on the Hydrolysis of…

A: Hydrolysis of starch is carried out in the presence of strach digesting Enzyme called amylase.…

Q: he Sanger method, like PCR, requires cycling hot/cold. Briefly explain why? There could potentially…

A: A rapid diagnostic test is one of the most used ways to check the presence of the covid-19…

Q: The ATP yield from TCA cycle starting with two molecules of acetyl CoA is....... a) 15 ATP. b) 24…

A: Introduction: TCA cycle which is also known as the Kreb cycle is the last common oxidative pathway…

Q: 3. What will the flow rate be in milliliters per hour for vancomycin 1g/500 mL IV, if it is to be…

A: Given Values: Total IV = 1g /500 ml Total time for infusion = 90 minutes

Q: Which of the following statements is true about the control of muscle glycogen phosphorylase? a) It…

A: Introduction: Glycogen phosphorylase is a key enzyme that takes part in the first step of…

Q: Which of the following is true about zymogens? A. Proproteins are one type of zymogen. B. Zymogens…

A: Zymogens are precursors of enzymes that are converted into active Enzymes by the process of…

Q: Which of the following secondary structures would you expect to find on the surface of a globular…

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: is amino acid 213 in 1mry is THR ?

A: 1MRY crystal structure represents the structure of the akt2 kinase domain. It belongs to a…

Q: True or False In the presence of enzymes, the value of free energy of activiation (delta G°‡) for…

A: Enzyme: It is a biocatalyst that increases the rate of chemical reaction by lowering the the…

Q: Paul and his friends ate at a fast-food restaurant. Paul, who has a mass of 70 kg, had a…

A: MET or Metabolic Equivalent of Task is defined at the ration of the rate at which an individual…

Q: The H-precursor of ABO blood group system consists of proteins on to which sugar moles not present…

A: The type of oligosaccharides present on the red blood cells surface determine the blood type of the…

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Cancer means uncontrolled cell division. There are several therapeutic agents are used to treat…

Q: create figures using the following information and explain the results effect of the…

A: Time(mins) 15° 37° 65° 0 >3 >3 >3 2 >3 >3 >3 4 >3 1.831 >3 6 >3…

Q: Which of the following types of covalent bonds are found in the structure of ATP? Phosphoanhydride,…

A: ATP is adenosine Triphosphate that consists of adenine, 3 phosphate groups and a ribose sugar. It is…

Q: what is the purpose of this experiment Effect of Temperature on the Hydrolysis of Starc

A: Introduction: Enzymes are proteins that act as biological catalysts to fasten the rate of the…

Q: The task in this assessment is to describe how a specific gene is replicated and used to make its…

A: In most human cells there is a structure called nucleus. The nucleus contains the genome. in humans…

Q: What is the bacterial toxin that prevents the docking of synaptic vesicles at the neuromuscular…

A: Acetylcholine is the principal neurotransmitter in the neuromuscular junctions. Clostridium…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below:

EcoRI: 20 kb

BamHI: 11 kb, 6 kb, 3 kb

EcoRI + BamHI: 8 kb, 6 kb, 3 kb

If the double digest produces 4 fragments, with only 3 sizes what is the largest fragment size?

3.0kb

4.0kb

2.0kb

8.0kb

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

pMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb What is the largest fragment size that the BamHI/EcoRI double digest produces? 2.250 kb 2.500 kb 2kb 8 kb
pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb How many times does the enzyme NcoI cut? 1 2 We don't know from the information given. 0
pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb If the BamHI/EcoRI double digest produces only 3 fragments what are their sizes, why is this so? There are two 3 kb fragments There are two 6 kb fragments There are two of the same size fragments, but we don't know which. We cannot determine this from the information given.
pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI: 11 kb, 6 kb, 3 kb EcoRI + BamHI: 8 kb, 6 kb, 3 kb How many times does the enzyme BamHI cut? 1 2 3 4
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Arg CỦA CCA CAA CGA Gin CUG CCG CAG CGG AUU ACU AAU AGU Ser Asn What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AGA AAA arg Lys Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base Third Base
4.08 H H 1.02 2.54 11.021 E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H = Hindill site H 0.81 EE 1.76 1.10 Fragment sizes are not to scale and all fragment lengths are in kilobase pairs (kbp) Draw the appearance of the autoradiogram of the Southern blot after hybridization with a cDNA probe. I
The following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?
Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
See the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.