Please help me with these QUESTIONANSWERConsider the following peptide sequence:pH less than 4КККАКААКККАККpH greater than 11pH between 4 and 11At physiological conditions this peptide has a random coilconformation. Under what solution conditions might thissequence form a helical conformation?pH - 7I DON'T KNOW YETsubmit QUESTIONANSWEREnzyme-catalyzed reaction coordinate diagrams have an initialintermediate that represents anenzyme binding to the transition stateenzyme changing shapeenzyme binding to the substrateenzyme binding to the productsI DON'T KNOW YET

Peptides are formed by amino acids. The bonds linking individual amino acids are peptide bonds.…

Answered: Please help me with these

Science

Biochemistry

Please help me with these

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter31: Completing The Protein Life Cycle: Folding, Processing, And Degradation

Section: Chapter Questions

Problem 3P: Understanding the Relevance of Chaperones in Protein Folding Protein molecules, like all molecules,...

See similar textbooks

Related questions

Q: Can you help me answer this?

A: The term "homeostasis" refers to the body's continuous interior environment. Stasis = standing;…

Q: I need answer

A: Performance management is an organizational process that focuses to ensure that predefined outputs…

Q: need help

A: Recombinant DNA technology plays a vital role in in vitro experiments for producing the organism…

Q: Please help urgently with this question please?

A: Actin is a globular protein that forms microfilaments, a type of cytoskeleton present inside most of…

Q: Please help me with this

A: Name functional group structural formula condensed formula Butanoic acid -COOH CH3CH=CHCO2H…

Q: D

A: Cell membrane is one of the major components of the cell. The membrane consists of bilayer of…

Q: Please ASAP. Thank you

A: From above questions Correct pairing of scientist and his contribution given below.

Q: Help with the wrong ones please

A: Note: Since you asked for only the wrong ones, we are answering them according to their order.

Q: Please advise

A: Appositional growth is the expansion of the cartilage matrix from within. It includes…

Q: I need answer this question

A: We know that The digestive system is made up of the gastrointestinal tract and accessory organs.…

Q: Ф a a A Aa Aa A Aa AA and aa.

A: Alleles are alternative forms of genes and can be of two types: dominant and recessive. We use…

Q: Question 18

A: Answer Ampicillin antibiotic inhibit cell wall synthesis. It acts as an inhibitor of…

Q: I needed help me

A: Half life of a drug is an estimte of the time it takes for the amount of the drugs active substance…

Q: pesticides

A: Definition of Pesticide: Pesticides are the substances which are meant to control the pests.…

Q: Kindly refer to the photo attached, thank you so much!

A: There are 20 standard amino acids that make up all the proteins inside the cell. The amino acids are…

Q: I need help to write the name of the lable on A, B, and C

A: A cell is the structural and functional unit of life. Every living organism is made up of cells.…

Q: ||||

A: Activation energy is the minimum energy required for the reaction to initiate and this energy…

Q: The ability to curl the tongue is a

A: Answer: Inheritance : It is the process of gaining some characteristics or properties from parents…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase) Mitosis is a type of cell division in which a cell…

Q: PLEASE HELP ASAP. If some structures are not in the picture it's okay

A: Introduction:- The female reproductive system of rabbit made up of a one pair of ovaries, small…

Q: nes smaller.

A: A flock of Darwin finches migrate to an island where seeds are large. Finches adapt themselves and…

Q: please explain

A: Introduction: A membrane's voltage varies rapidly in a series known as action potentials. The…

Q: I need to answer this question, Thank you

A: Ans: Potential energy

Q: 3. 9, 2

A: The diagram represents the lymph node. It is a small swellings in the lymphatic system. The lymph is…

Q: Can you please check if my selections are correct?

A: During the process of gastrulation in a developing embryo, cells migrate to the interior part of the…

Q: Help me to answer those questions please

A: Tonicity refers to osmotic pressure gradient. It is defined as relative concentration of solutes…

Q: please help me in answering all even without explanation, thank you so much... please please

A: Gluconeogenesis (GNG) is a metabolic pathway that results in the generation of glucose from…

Q: Help me label

A: The nervous system is a complex assortment or collection of nerves and concentrated cells known as…

Q: Could you please let me know if these look labeled correctly? Specifically letter f?

A: The mentioned diagram describes skin anatomy.

Q: please help?

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Hi can someone help me please. The picture contains the full structure.

A: Biomolecules are organic molecules that are mainly composed of carbon, hydrogen, oxygen, nitrogen,…

Q: Fill in the blanks please.

A: Endocrine system regulates biological processes in the body. Different hormones are released from…

Q: hormone level in blood

A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…

Q: I want more information about this information

A: Germination is a process by which a plant or seedling sprouts from a seed or from a spore. The…

Q: Please help me with this question urgently within an hour?

A: BASIC INFORMATION CELL DIVISION It is necessary for all the cells. In this the parent cell…

Q: I need help label name

A: We know that The development of the embryo and of the fetus during the gestation period is known as…

Q: Please explain how did this reaction happened.

A: Molisch's test is a qualitative test used to detect the presence of carbohydrate in a sample. In the…

Q: Says passi Voice is generan ung as section. True False

A: while writing methodology few things to be followed. 1. write aim of the experiment 2. principle of…

Q: can i get help with this??

A: Transcription is the process by which the mRNA is synthesized from a DNA. During this process, one…

Q: Can you help me with this picture

A: Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by…

Q: Can you please tell me all the parts in the picture? Please just label them clearly thank you.

A: Cell structure is different in both prokaryotes and eukaryotes.

Q: 4. A DE R

A: A phylogenetic tree is kind of a branching diagram or a kind of tree that shows the evolutionary…

Q: I do not get this at all can you help me out

Q: I need help don't copy

A: We know that In the prostate gland, the development of a cell is out of control that causes prostate…

Q: Is this correct? Thanks.

A: The correct option is b all the answers here are correct.

Q: A

A: Base pairing in DNA is complimentary such that A always pairs with T G always Pairs with C the…

Q: Please help me in the fraction part please and thank you!! ASAP!!

A: A dihybrid cross describes a mating experiment between two organisms that are identically hybrid for…

Q: muscles,

A: Muscles are soft tissues. Many stretchy fibers make up your muscles.muscles help you run, jump or…

Q: Please tell me what are the correct answers.

A: According to Mendel, every character or trait is regulated by a particular gene. A gene is present…

Question

Please help me with these

QUESTION
ANSWER
Enzyme-catalyzed reaction coordinate diagrams have an initial
intermediate that represents an
enzyme binding to the transition state
enzyme changing shape
enzyme binding to the substrate
enzyme binding to the products
I DON'T KNOW YET

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Question What is the net charge for the following peptide at pH = 7 (neutral pH)? Ser-Trp-Arg-Gln-Glu-His-Lys-Asp
Peptide sequence using 1-letter code for amino acids: EDLSMTCFRH What is the net charge of this peptide at pH 9? Use the pKa values from Table 4-1 from Voet, Voet and Pratt. -2 -1 O +1 +2
Purification of a new unknown protein that you isolated from tissue and Assume that you have reached the following data during the characterization; Gel filtration: Gel filtration in protein native conformation When chromatographed, it has a molecular weight of 240000 daltons (240 kDa) is detected to be around. Gel filtration: The same protein is first denatured with 6 M guanidinium hydrochloride subjected to gel filtration chromatography again under denatured conditions. is retained, and the only column from the column with a molecular weight of about 60000 daltons (60 kDa) a protein is obtained. SDS-PAGE: Protein finally SDS-PAGE in the presence of beta-mercaptoethanol (Sodium dodecyl-sulphate polyacrylamide gel electrophoresis) analysis being held. As a result of SDS-PAGE analysis, their weight in the gel is approximately 40000 daltons. Two protein bands corresponding to (40 kDa) and 20000 daltons (20 kDa) is observed. In the light of these findings, the quaternary/quaternary…
GABA (B) Need help answering these questions about the GABA(B) protein.  What class (globular, fibrous, membrane) protein is the protein Identify the organism (or organisms that have this protein) Identify the cellular location of this protein Describe the function Find the primary structure (list it on a slide) Describe secondary structure (alpha-helix, beta sheet, and how many of each and what percent of the total protein) Find a picture of the tertiary structure (which should also show secondary structure) Does the protein have a quaternary structure, if so what is it?
Determining the amino acid sequence in a protein usually in- volves treating the protein with various reagents that break up the protein into smaller fragments that can be individually sequenced. Treating a particular 11-amino acid polypeptide with one reagent produced the fragments: Ala-Leu-Phe-Gly-Asn-Lys Trp-Glu-Cys Gly-Arg Treating the same polypeptide with a different reagent pro- duced the fragments: Glu-Cys Gly-Asn-Lys-Trp Gly-Arg-Ala-Leu-Phe What is the amino acid sequence of the polypeptide?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.
Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity of the protein? 2. What is the importance of this protein?
GABA (B) protein Need help answering questions about the GABA(B) protein. What is the primary structure Describe secondary structure (alpha-helix, beta sheet, and how many of each and what percent of the total protein)What is the tertiary structure (which should also show secondary structure)Does the protein have a quaternary structure, if so what is it?
PEPTIDE #1: Pro-Phe-Thr-Cys PEPTIDE #2: Gly-Tyr-Ser-Asp Calculate the pI of both peptides. Which is more acidic and why? Which one is more hydrophobic? Which peptide sequence (#1 or #2) would be more likely situated on the surface of the protein?
Question:- Give a brief description of what the term ‘native protein’ state refers to. Your answer should make a specific reference to how the structural organisation of this state is accomplished
Understanding the Relevance of Chaperones in Protein Folding Protein molecules, like all molecules, can be characterized in terms of general properties such as size, shape, charge, solubility/hydrophobicity. Consider the influence of each of these general features on the likelihood of whether folding of a particular protein will require chaperone assistance or not. Be specific regarding just Hsp7O chaperones or Hsp7O chaperones and Hsp60 chaperonins.
a 3d structure of protein with acces number of P02008 at uniprot database.