Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in length. The DNA sequence of the lilP gene is shown below. 5'-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACTAGaaatattatttaa-3' 3'-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGATCtttataataaatt-5'
Q: For insertion elements and simple transposition, what is the function of the inverted repeat…
A: Transposition A transposon also called a jumping gene is the DNA sequence that changes its position…
Q: The measles virus is highly infectious. What vaccination rate would protect the population from a…
A: Introduction :- Measles is a highly contagious viral infection that primarily affects children,…
Q: Explain Clostridium botulinum
A: Bacteria are single-celled microorganisms that lack a nucleus and other membrane-bound organelles.…
Q: Based on the transduction pathway presented above, what type of receptor is the beta-3 adrenergic…
A: G protein-coupled receptors (GPCRs), also called seven-(pass)-transmembrane domain receptors,…
Q: Which of the following is true about essential nutrients? A) Essential nutrients are substances that…
A: Introduction :- Nutrients are substances that are required by the body to perform essential…
Q: 2. If a woman who has no dimples (recessive) and is homozygous free earlobes (dominant) has children…
A: Given that, having dimples is dominant over no dimples while earlobes is having incomplete…
Q: Which of the following electrolytes are absorbed only when needed a. Iron O a O b b. Calcium c.…
A: Introduction - Electrolytes are substances that, when dissolved in water or other solvents, can…
Q: William is a 13-year-old who is having frequent night terrors. William's parents take him to the…
A: Night terrors are episodes of screaming, extreme fear, and thrashing while a person is still asleep.…
Q: Which of the following statements regarding Antidiuretic Hormone signaling is false? - it involves…
A: Introduction :- ADH is a hormone produced in the hypothalamus and released from the posterior…
Q: nuclear lamina nuclear pores,
A: In eukaryotes, nucleus are membrane bound organelle which contain genetic information. This genetic…
Q: What are the advantages and disadvantages of using HPC therapy? 2) Compare and contrast the…
A: Hematopoietic progenitor cell therapy, also known as hematopoietic stem cell therapy, involves the…
Q: What is the positive and negative results of Oxygen Requirements of Microorganisms technique? (Brief…
A: Introduction Microorganisms, also known as microbes, are microscopic living organisms that are too…
Q: What role does the moisture content of rice paddy play in the overall quality and value of the crop,…
A: Introduction: Crop cultivation is a key agricultural process that is necessary for maintaining human…
Q: Some drugs require rectal administration because * they can undergo first-pass metabolism. O small…
A: Introduction :- Drugs are chemical substances that alter the normal function of the body when they…
Q: Your friend wants to develop a new method to map the transcription start and end sites of a target…
A: Introduction Transcription is the process by which genetic information in DNA is used to synthesize…
Q: In order to investigate the action of a bacterial membrane protein that is a light-driven proton…
A: You can determine whether a protein is a transmembrane protein by looking at the amino acid sequence…
Q: biocide type your answer... type your answer... type your answer... type your answer...
A: Introduction : According to European law, a biocide is any chemical agent or microorganism that is…
Q: Glycolysis can be thought of as a two-phase process: the energy investment phase and the energy…
A: Glycolysis is the metabolic process by which glucose is converted into pyruvate. It occurs in the…
Q: Select two primers from the list below such that your selected primers create a pair capable of…
A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…
Q: Identify the following puicture and describe why it is improtant in reproduction.
A: Genetic recombination is the process by which genetic material is exchanged between two different…
Q: 2 3 13 sidering the information, answer the Fowing questions: 5 the trait inherited as dominant or…
A: Pedigree explains the disease outcome or the phenotypic variation for a particular trait in a…
Q: responsible for transmitting a large fraction of vector-borne diseases.
A: INTRODUCTION Dipterans, also known as flies, are a diverse group of insects belonging to the order…
Q: Overall, making healthy lifestyle choices and being proactive about cardiovascular health can lead…
A: The heart is the muscular organ that is crucial to life as it stands beating from early fetal life…
Q: Draw the end results of I, MI, and MII and fertilization showing how an XYY individual could occur.
A: Meiosis is a specialized type of cell division that occurs in sexually reproducing organisms.…
Q: how do steroids/sterols chemical structure help with identifying lipids?
A: Introduction :- Steroids and sterols are a type of lipid that have a unique chemical structure that…
Q: 11. The following is a list of abiotic factors that would have a micro-effect on a tidal pool (rocky…
A: Answer :Water chemistry ( pH ,pollution etc) Reason: Abiotic factors are ecological elements that…
Q: Why are amino acids considered amphoteric compounds? How can stored fats in plants be utilized for…
A: Introduction Macromolecules are large, complex molecules made up of smaller units called monomers.…
Q: A mutant allele in persons with familial hypercholesterolemia (FH) causes death due to a lack of…
A: Introduction : Fatty acid derivative acetyl-CoA is used to make cholesterol. Cholesterol can also…
Q: explain precisely and concisely why hibernating animals accumulate large amounts of fat during the…
A: Hibernation is a profound rest that assists them with saving energy and endure the colder time of…
Q: The following diagram shows a lung with a large shunt in which mixed venous bypasses the oxygen…
A: Introduction:- Oxygen tension of aerial blood is about 12 to 140/0 ifan atmosphere, and is always a…
Q: CASE 3 As a genetic counselor, you have been asked by a family to describe the mode of inheritance…
A: By observing the pedigree of a family we can determine the mode of inheritance of a particular…
Q: hi can you please help me review this vedio including vedio topic presented, the information…
A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a revolutionary gene-editing…
Q: The initiative-versus-guilt stage of psychosocial development is characterized by a child feeling a…
A: The initiative-versus-guilt stage of psychosocial development, according to Erik Erikson's theory,…
Q: Which of the following factors can affect the effect of drug?…
A: Introduction :- A drug is any substance that alters the normal function of the body when it is taken…
Q: what did percy lavon julian do (add pictures please)
A: Medicines are designed to treat illnesses and medical conditions. They help to alleviate symptoms,…
Q: primary and metastatic uveal Mel202 and OMM1.3 cells.
A: NOTE- AS PER OUR BARTLEBY GUIDELINES , IF MULTIPLE QUESTIONS ARE GIVEN WE HAVE TO SOLVE ONLY FIRST…
Q: Contrast what is going on in the heart with each part of a blood pressure reading (like, 120 over…
A: There are teo main phases in the functioning of heart. These are systole and diastole. Together,…
Q: Two human populations have been isolated on islands since their ancestors first arrived. The mtDNAs…
A: Mitochondrial DNA (mtDNA) is a circular DNA found in the mitochondria of cells. It is only inherited…
Q: how are family, teens, community and society impacted with Unintentional injuries from a vehicular…
A: Introduction: RTA stands for "Road Traffic Accident." It refers to any incident that occurs on the…
Q: plasma membrane Chromatin
A: A cell is the basic unit of life. It is a small structure that performs all the functions necessary…
Q: Explain why it has been very difficult to obtain an X-ray crystal structure for the complete nuclear…
A: A substantial and intricate protein structure called the nuclear pore complex (NPC) covers the…
Q: A cell is grown on minimal media containing only glyceraldehyde 3-phosphate as a source of carbon…
A: Introduction :- Glyceraldehyde 3-phosphate (G3P) is a three-carbon molecule that is an important…
Q: 9. F. A. B. E. C. D. The allele for normal skin pigmentation (A) is dominant to absence of…
A: Introduction :- Albinism is a genetic condition characterized by a lack of pigmentation in the skin,…
Q: Write a short essay commenting on the following statement:- “Comparatively-speaking, it is better to…
A: Introduction The kidney is a vital organ in the human body that plays a crucial role in maintaining…
Q: fill in the blank: a. lincRNA plays a role in regulating ___ making genes but they themselves are…
A: Introduction :- LincRNA plays a role in regulating gene expression. LincRNAs (long intergenic…
Q: Differences and similarties of ester and glycosidic linkage?
A: Ester and glycosidic linkages are two types of covalent bonds that are commonly found in biological…
Q: List the determinants of blood pressure and describe the baroreceptor reflex response for the…
A: Introduction Blood pressure refers to the force of blood against the walls of arteries as it is…
Q: Decide which sentences describe natural selection and which are common misconceptions. True…
A: Natural Selection: Natural selection is a process by which certain heritable traits become more or…
Q: can you please help me review this vedio including vedio topic presented, the information provided…
A: During the last decade of 2020 some diseases appeared that were never existed before. The common…
Q: tabulate the morphological differences of soft-rayed and spiny-rayed fishes.
A: Introduction Morphological differences refer to differences in the form and structure of organisms…
Step by step
Solved in 2 steps
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThe bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGATranscribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 1317) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’