O A. cutting out a DNA sequence. B. changing a DNA sequence. C. reinserting DNA into living organisms. D. recombinant plasmid gets inside a bacterial cell E. DNA polymerases are used to seal the bonds between fragments O O
Q: You see partial sequence of a gene as follows (non template strand shown) ...TATAAA(8nts)GGCCAAGGAG...
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific ...
Q: Glomeromycota help extract resources for plants to grow. The plant provides the Glomeromycota with c...
A: Introduction: Symbiosis :relationship between two different organisms living in close proximity, usu...
Q: Water stored in aquifers eventually flows back into rivers and lakes. reservoirs. sewers. wells.
A: When water enters an aquifer, it moves slowly toward lower-lying places and eventually is discharged...
Q: What are DNA methyltransferases (DNMTS) ?
A: Enzymes are protein molecules that aid in increasing the rate of metabolism and chemical reactions i...
Q: effect of malaria on the frequency of the HbS allele in areas where malaria is common:In areas with ...
A:
Q: Which of the following processes requires the cell to expend metabolic energy directly (e.g., from A...
A: Metabolism is a series of life-sustaining biochemical systems which allow creatures to convert chemi...
Q: Which of the following ideas aided in the development of our current understanding of evolution? (Pl...
A: Uniformitarianism is a principle that suggests that claims that processes operating in the present a...
Q: What is shown in the image above? one doubly compound leaf many simple leaves needle-like leaves tha...
A: A doubly compound leaf or bipinnate leaf is a leaf that is divided twice in which the leaflets are a...
Q: What is phylogeny? Why is it considered an important field in understanding evolutionary processes?
A: Phylogeny is the representation of the evolutionary history and relationships between groups of orga...
Q: A microorganism found living under conditions of high ________ is a barophile. carbon dioxide leve...
A: A microorganisms naturally grow in conditions that are far from optimal, which causes them to become...
Q: Suppose a girl ate too many sweets such as chocolates. How will the hormones (insulin) from her panc...
A: *suppose if a girl eat too many chocolates then the sugar level will be increased in her blood which...
Q: What are two obvious differences in plant and animal cell division?
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading ...
Q: Which item is biggest? A. myosin head B. myofibril C. troponin D. sarcomere
A: Muscles are compact structures made up of highly tensile , strong, long, multinucleated cells called...
Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following g...
A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C cont...
Q: As an aspiring pharmacist, what is your view on the use of pain killers and anti-inflammatory drugs?...
A: Immunity refers to a state of health or immunity. It can also be defined as the organism's resistanc...
Q: how are fats digested in our bodies?
A: Digestion involves the breaking down of complex food particles into smaller ones so that they can be...
Q: What are the main features of animal husbandry? Explain thoroughly.
A: Animal husbandry represents the branch of agriculture that is about the care and rearing of livestoc...
Q: . A girl has green-red CVD (colour vision deficiency) which is an X-linked recessive trait. What are...
A: There are two points of information which define the answer:- The offspring is a girl Disease's inh...
Q: Difference of metaphase from metaphase I
A: Metaphase is a basically a phase in mitosis and metaphase I is a phase in meiosis. The major differe...
Q: Which of the following is NOT a feature associated with filtration? sterilization of heat-sensitiv...
A: Filtration is a process in which the smaller or liquidy substances can be removed from the larger so...
Q: IDENTIFICATION: Provide the required information. Examine the pedigree charts A and B. Shaded indivi...
A: Genetic disease The disease which transfer from parents to their offsprings. They may be sex linked...
Q: 90 80 70 60 R² = 0.2941 50 40 20 10 20 40 60 80 100 120 140 160 180 200 Height (in cm) Weight (in kg...
A: Regression analysis is a statistical method use to determine the relationship between two or more va...
Q: I don't understand, pls help ASAP!
A: The beta-sheet of the spider comprises the alanine.
Q: If individuals vary, and variation affects survival and reproduction, and variation is heritable: t...
A: Charles Darwin developed a theory of evolution to explain the unity and diversity of life, based on ...
Q: Based
A: If at the start of the experiment there is one cell and at end of first-generation there will be 2 c...
Q: What is meiosis
A: Meiosis, also known as reduction division, is the division of a germ cell that involves two nucleolu...
Q: Tabulate the comparison between Mitosis and Meiosis. Make it brief and concise.
A: A live cell possesses the ability to replicate itself independently. In living organisms, each cell ...
Q: The species Canis Lupus (Gray Wolf) is most closely related to which of the animals listed: Group of...
A: ANSWER;- All options are wrong Explain;- The species Canis Lupus (Gray Wolf) is most closely related...
Q: How would you distinguish a stem cell from a B cell at the DNA level
A: Introduction: A stem cell is a type of cell that has the unique potential to differentiate into many...
Q: How could you distinguish between an autosomal recessive trait with higher penetrance in males and a...
A: An individual with the autosomal recessive disease will have unaffected parents since the offspring ...
Q: In yeast cells, telomerase remains active and maintains telomeres of about 300 base pairs. Propose w...
A: Telomeres play a very important role in preserving our genome information.
Q: This diagram shows a _______ and the green things being released into the space are _____. A. cardia...
A: The branch of biology associated with studying the functions of living organisms’ body can be referr...
Q: Describe the mutation that created the HBs allele: type of mutation, location of mutation on HbA seq...
A: Describe the mutation that created the HBs allele: type of mutation, location of mutation on HbA seq...
Q: A phylogenetic tree is different from a cladogram in that it shows that all species are not related ...
A: Answer The correct option for this question would be It represents the time scale of evolution, in...
Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is t...
A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It ta...
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A...
A: Point mutations can be defined as mutations in single nucleotides. In point mutation, a nucleotide m...
Q: Mutations can sometimes happen in the sex chromosomes. What is the effects if a female has a missing...
A: Answer :- when mutations happen in sex chromosomes then it effects female has missing sex chromosome...
Q: Write out the sequences of the two conserved elements in the following bacterial promoter. The start...
A: In the transcription unit, the transcription start site is marked as +1.
Q: What allows for intervening sequence between a promoter and a regulatory to be looped out so that a ...
A: Bacterial genes are often found in operons and the Each operon contains regulatory DNA sequences, wh...
Q: How do the nitrogen-fixing genera Azospirillum and Rhizobium associate with plant roots? Rhizobium...
A: Option 3 is correct (Azospirillum stays on the outside of the roots of tropical grasses, while Rhizo...
Q: which antimicrobial drugs are produced naturally?
A: Antimicrobial drugs produced naturally are Biofilms. Biofilm is assemblage of surface -associated mi...
Q: In glycolysis and the Krebs cycle, electrons are removed from glucose and taken up by molecules + li...
A: In glycolysis and the Krebs cycle, electrons are removed from glucose and taken up by molecules + li...
Q: Select the correct pathway in the angiosperm lifecycle. Sporophyte - mitosis - spores - gametophyte ...
A: Angiosperm, also known as flowering plants, is the largest and most diverse group of flowering plant...
Q: omega-3 fatty acids?
A: Omega-3 are nutrients you get from food that help build and maintain a healthy body. They're key to...
Q: rly childhood education( infant, toddler and caregiver).
A: Roles of an adult in a infant-toddler education:- Making children explore common objects and train ...
Q: A phylogenetic tree is different from a cladogram in that ... Group of answer choices A: it represen...
A:
Q: Does closing of the leaves of the Makahiya plant once touched considered as thigmotropism? Why or wh...
A: Thigmotropism is directional plant growth movement where particular part of plant body move or res...
Q: 120 20 Feeling 102 100 99% 104 80 0.2 95%. 106 60 0% 2x102 108 40 75% 2x10 1% 50% 10-10 20 5% 2x104 ...
A: Ear is the organ that enables hearing and, in mammals, body balance using the vestibular system.
Q: Which of the following changes in morphology or physiology are likely to happen as an organism gets ...
A: Answer :- Option (H) is correct. - All of the above. - The changes in morphology or physiology are l...
Q: Consider the ventricular cardiomyocyte action potential shown below: a) Which phase of the cardiac m...
A: Answer :: a) Signal transduction pathways translate signals received at the cell's surface into cell...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.Q: Hyperglycosylated genetically engineered proteins synthesized by some micro-organisms are usually induce human immune system O True a O False .b Q: Find the incorrect statement about plasmids CO they are circular a they replicate independently .b they are transferrable .c they are single stranded .d Q: Discontinuities of DNA nick can be fixed by ........... activity Nuclease .a Modifying enzymes .b O Ligase .c O Polymerisation d Q: Frameshifts means missreading of right sequence of a inserted genes presence of mutation that disturb the b sequence order a process that leads to generate .c different protein sequence All choice .d none of choices.e Q: Despite some drawbacks, E. Coli remains the most frequently used microbial eukaryote for recombinant protein synthesis O True .a O False .b Q: Even when the recombinant proteins are produced in mammalian cells, there are still some drawbacks can be occurred such as Protein folding a The yield of recombinant protein b Recombinant Protein…What is the correct order for the steps of transformation given inthe following list?1. Recombination with the bacterial chromosome2. Binding of a large DNA fragment to the surface of a bacterialcell3. Cutting a large DNA fragment into smaller pieces4. Uptake of DNA into the cytoplasm5. Degradation of one of the DNA strandsa. 1, 2, 3, 4, 5b. 2, 3, 5, 4, 1c. 2, 3, 4, 5, 1d. 2, 5, 4, 3, 1
- 4. In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain.a. How would you know that gene transfer is takingplace?b. To determine if the gene transfer is transformationor transduction, you treat the mixed culture of cellswith DNase. Why would this treatment distinguishbetween these two modes of gene transfer? Describethe results predicted if the gene transfer is transformation versus transduction.c. To determine if the gene transfer involves transformation, conjugation, or transduction, you separatethe ampicillin-resistant and ampicillin-sensitivestrains by a membrane with pores that are smallerthan the size of a bacterium, but larger than thesizes of bacteriophage or DNA fragments. If genetransfer is still observed, what mechanisms arepossibly involved and which are excluded?4. In bacterial cells, nucleotide excision repair involves which of the following proteins?A. DNA glycosylaseB. AP endonucleaseC. photolyaseD. AlkBE. UvrABC proteins 5. If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is:A. constructiveB. semiconservativeC. conservativeD. consecutiveE. cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair?A. DNA polymerase IB. DNA polymerase IIC. DNA polymerase IVD. DNA polymerase VE. none of the above4. What is the name of the process by which bacteria pick up a different organism’s geneticmaterial?5. Genetically, how does the original bacterial DNA (plasmid) differ from the final bacterial DNAmolecule? (Do not say, “It is longer.”)6. Tetracycline is an antibiotic that is prescribed to kill bacterial infections. The transformedbacterial cell that you created has the tetracycline resistant gene in it. If this cell is placed on agrowth medium with tetracycline, will the bacteria grow or die? Explain.
- Q: Antibiotics are used in genetic engineering. They are useful to keep culture free of microbial a O infections O to select healthy vectors .b O to identify replication start sites.c O as selectable markers .d Q: Choose the best choice that describes the purpose of adding chloramphenicol to the culture of engineered bacteria O It inhabits the process of protein a synthesis O It blocks chromosome replication .b It blocks cell division .c It leads to increase the copy number of d recombinant molecules Q: Alkaline denaturation process is a kind of DNA isolation on the basis of conformation, that cause insolubility of cell components except one of the following Supercoiled DNA a Chromosomal DNA b Protein molecules c RNA molecules d All choices.e None of choices f Q: After transforming the ligation mixture into the E. coli, the transformed and non- transformed bacteria both can grow on media .containing antibiotics True a O False ..b5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
- Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…8. Which of the following is the complementary base pairing of the DNA sequence 5' ATTCGGCTTA 3'? a. 3' TAAGCCGAAT 5' b. 3' ATTCGGCTTA 5' c. 5' TAAGCCGAAT 3' d. 5' ATTCGGCTTA 3' 9. Why is DNA polymerase I used in prokaryotes? a. to repair damage to DNA base pairs b. to remove DNA sequences to form plasmids c. to fill in gaps between Okasaki fragments along the lagging strand d. to add DNA nucleotides to build new strands 10. Which set of labels is correct for the following diagram of DNA replicating? E Z A T C ATAGAC direction of replication C a. b. Alignment Paired Y C. d. Anti-parallel AATA GTT D a. X is helicase, D is ligase, and E is leading strand. b. X is gyrase, Z is leading strand, and D is single-strand bonding proteins. c. X is helicase, Y is replication fork, and D is single-strand bonding proteins. d. X is topoisomerase, Y is replication fork, and E is leading strand. 11. What term is used to describe the direction by which the backbone of DNA strands run to each other?…8. Using recombinant DNA techniques (which willbe described in Chapter 9), it is possible to take theDNA of a gene from any source and place it on achromosome in the nucleus of a yeast cell. Whenyou take the DNA for a human gene and put it into ayeast cell chromosome, the altered yeast cell canmake the human protein. But when you remove theDNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome inthe nucleus, the yeast cell cannot synthesize the correctprotein, even though the gene comes from the sameorganism. Explain. What would you need to do to ensurethat such a yeast cell could make the correct protein?