Which one of the following contains nicotinic receptors?Adrenal glandsSmooth muscleCardiac muscleSweat glandsSalivary glands

Answered: nicotinic receptors?

Science

Biology

nicotinic receptors?

Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)

8th Edition

ISBN:9781305634350

Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Chapter4: The Muscular System

Section: Chapter Questions

Problem 69LE

See similar textbooks

Related questions

Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: Ultraviolet light principally causes which of the following dmages to DNA? A methylation of specific…

A: UV light can kill cells by damaging DNA to an irreversible extent. The light initiates reaction…

Q: Organisms that produce offspring that always look like the parents are said to be: O Purebred/Pure…

A: Organisms that produce offsprings that always look like the parents are said to be.

Q: Enzymes that acetylate the e-amino group of lysine in the histone tails are called and are involved…

A: Histone is made up of majority lysine and arginine (positive amino acids) as a result negative…

Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…

A: Transcription is the first step in the gene expression which transfers the genetic information…

Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?

Q: Cite 4 important Glycobiology applications or studies

A: Glycobiology is the branch of Biology that deals with the study of the structure, function,…

Q: Partial 0.75 /1 pts Question 8 Where is carbon stored on Earth? Check all that apply. V rocks and…

A: Carbon is one of the most important elements to humans since all organic compounds and most…

Q: What is the Ro for a population with 300 susceptible individuals (S) at time zero, a transmission…

A: The estimated number of cases directly generated by one case in a community where all individuals…

Q: How the presence of Pseudomonas aeruginosa in lungs aggravate the condition of patient having Cystic…

A: The airways of patients with cystic fibrosis (CF) are exceptionally complicated, concerned with…

Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…

A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…

Q: The process of __________ usually involves modification and selectivity

A: Introduction Breeding is a type of sexual reproduction that results in formation of offspring, which…

Q: Electrical impulses travelling from a point of origin to adjacent regions of the cortex is referred…

A: A sudden uncontrollable electrical disturbance on the brain is known as seizure. Causes change in…

Q: Adaptive radiation is when populations diverge from a common ancestor into new species, each of…

A: Adaptive radiation/ convergence is a phenomenon in which populations can undergo two processes:-…

Q: Which of the following would happen under the constrained physical activity model? O a. Individuals…

A: A state of "physical fitness" can be defined as a condition of well-being. Bodily health is a…

Q: Which of the following is the inner most layer of human eye? a) Retina b) Choroid c) Sclera d)…

A: Introduction - Our visual organ is the eye. Because of its intricate construction, an image can flow…

Q: 1. requires ATP A. diffusion 2. random movement of molecules from high to low B. facilitated…

A: Diffusion is the movement of molecules from a high region to a low-concentration area via random…

Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…

A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…

Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…

A: * Skeleton is the framework of human body which is composed of 270 bones at birth and can be…

Q: Diagram a translocation arising from repetitive DNA.Repeat for a deletion.

A: Changes in the structure of chromosomes may create issues with the body's systems' development,…

Q: Which cell secretes the matrix for bone formation? a) Osteoclastoma b) Osteoclast c) Mesoblasts d)…

A: Introduction - The creation of bones is known as osteogenesis or ossification. Following the…

Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…

A: *Sperm is male reproductive gamete that produce motile sperm with a tail called as flagellum…

Q: Glucocorticoids are __________ hormones secreted by __________ glands. Multiple Choice peptide;…

A: Glucocortioids are the hormones that is used for the treatment of the inflammation, autoimmune…

Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions

A: The main function of evolutionary scientists is how the today's organisms evolved into the current…

Q: The fossil Neanderthal bones from Shanidar Cave were surprising because they showed that…

A: *Neanderthals are subspecies of archaic humans of Eurasia about 40,000 years ago. factors like small…

Q: Describe the steps of transcription in eukaryotes

A: Eukaryotic transcription is carried out in the nucleus of the cell by one of three RNA polymerases,…

Q: Which option would not disturb a Hardy-Weinberg Equilibrium in a population? a) Random mating b)…

A: Hardy-Weinberg Equilibrium is the theory of population which states that the genetic variation in a…

Q: state why simplicity and speed are top priorities in selecting DNA isolation method

A: * Deoxyribonucleic acid that is isolation is the extraction process of DNA from other sources. * The…

Q: If you examined an en-GFP transgenic fly, where would you expect to see GFP expression? O In the…

A: *GFP can be introduced to animals by using transgenic techniques will be maintained in their genome…

Q: The mechanism of activation of eukaryotic genes involves addition and removal of phosphate residues…

A: The eukaryotic system has a general trend of activating anything by phosphorylation and vice versa.…

Q: In microscopy, what could be the possible reason why we cannot completely resolve the specimen under…

A: A microscope is a lab instrument used to examine the objects that are too small to be seen by the…

Q: A computer virus is capable of replicating itself.What other features of computer virus are similar…

A: Introduction A virus is a small piece of genetic material, such as DNA or RNA, encased in a protein…

Q: e the presence of saliva

A: Saliva is a thick, colourless, opalescent fluid that is constantly present in the mouth of humans…

Q: Discuss the environmental consequences of biomaterials compared to non-biomaterials.

A: A biomaterial is a substance that has been developed to interact with biological systems for…

Q: Q4 - What are two features of your protein's (Phosphoenolpyruvate carboxykinase, PCK1) structure…

A: Answer-4 A protein is a normally occurring, extremely complex substance that consists of amino acid…

Q: Explain why dichloromethane is a good solvent to remove the fat from the milk? Can you use organic…

A: Dichloromethane is a good option for milk fat removal. The reason is: Dichloromethane is a polar and…

Q: A patient has just been brought into the Accident and Emergency (A&E) department of the local…

A: The stock solutions can be diluted to achieve the desired concentration. The calculations are based…

Q: Chapter 23- Diseases of the Digestive System Match the description on the left side to the correct…

A: INTRODUCTION Answer to the question 41-50 is given below.

Q: Your uncle has tried every diet under the sun, yet he is still a very large man. He probably has…

A: When a person eats excess food and is not put into use then this food turns into fat reserve which…

Q: A potato cube is placed in a solution. The volume of the potato increases. which statement below is…

A: Osmosis is a process of flow of solvent molecules from lower concentration to higher concentration…

Q: In 1947, Donal Hebb took some rats home from his lab at McGill University. Hebb let these rats grow…

A: Main morphological difference between neurons of rats growing in laboratory v/s rats growing in…

Q: Thomas, a 62-year-old man, is experiencing pain in his left chest and left arm. When he reaches the…

A: Introduction A heart attack occurs when blood flow to a part of your heart stops, one or more of…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: An individual cannot be a carrier for a dominant disorder they will express it. True False

A: Introduction :- A single copy of the disease-associated mutation is enough to cause the condition in…

Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a slide without…

A: A simple microscope is a magnifying glass with a short focal length and a double convex lens. The…

Q: What is pecten and what is thought to be its function? 2. Please describe the typical hunting…

A: Note- As per Bartleby rules, we are supposed to answer only first three questions. Kindly repost The…

Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…

A: There are few important points: A population genetics is the study of changes in the frequencies of…

Q: Draw two tubes showing how you have inoculated microorganisms in urease and in nutrient agar

A: Inoculation is the transfer of the bacteria on the nutrient medium to show its growth. The tools…

Q: born with sickle cell anemia. What is the frequency of individuals in this population who do not…

Q: Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А B

A: *pictomicrographs shows the photograph of objects under a microscope. * objects like metal and…

Question

Which one of the following contains nicotinic receptors?
Adrenal glands
Smooth muscle
Cardiac muscle
Sweat glands
Salivary glands

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following contains nicotinic receptors? adrenal glands smooth muscle cardiac muscle sweat glands salivary glands
Nicotinic receptors are also considered what? Adrenergic Sodium channels O Enzymes Inhibitory Big babies who complain too much
Which of the following nerves causes the .24 adrenal medulla to release epinephrine and * ?norepinephrine sympathetic O parasympathetic somatic #Medical Team HU CamScanner W da gunnall
Which of the following responses are regulated by the parasympathetic nervous system? (Select all that apply). Reducing heart rate Dilation of the bronchioles O Increasing digestive enzyme release O Pupil constriction Penile erection O Dilation of coronary blood vessels
All the following regarding sympathetic nervous system are true except: * It is involved in stress & emergency conditions. It has a vasodilatory effect on skeletal muscle blood vessels during rest. All its preganglionic fibres are cholinergic. Its stimulation increases the cardiac properties. E O Its stimulation causes urine retention.
Which of the following would cause muscle paralysis? An antibody that blocks nicotinic acetylcholine receptors A beta-adrenergic receptor agonist A serotonin reuptake inhibitor An acetylcholine esterase inhibitor Nicotine
The motor end plate is extensively folded to allow for a greater number of what structures? Terminal cisternae Transverse tubules Cholinergic receptors O Myofibrils Parking spaces. Too bad WSU doesn't have motor end plates.
Circulating glucocorticoids (e.g. cortisol) can inhibit the activity of the HPA axis via the negative feedback loop working on the Hippocampus Amygdala Limbic cortex Thalamus O All of the above
Carbachol have longer durations of action than Ach, because they have both muscarinic and nicotinic activity. they are not hydrolyzed by AChE. They bind to muscarinic receptors. They show little specificity in their actions O
Which of the following systems is predominantly stimulated by nicotine action in parasympathetic nerves
The parasympathetic system has vital role maintaining Heart Rate Muscular tone Lung expansion Suprarenal secretion
Nerve impulses are sent bidirectionally. True O False