Q: What is the ratio of the possible phenotypes of the offspring when you cross the cats in the image
A: Inheritance is the foundation upon which heredity is built. It is described as the process through…
Q: Choose the mismatch: Feature a. Bilateral symmetry b. First triploblastic c. free-living flatworm d.…
A: The eukaryotic multicellular organisms that belong to the biological kingdom Animalia are referred…
Q: "apoA, apo(a), apoB, apoC and apoE" "apoA, apoB, apoC, apo E, and apol" O "apoB, apoC, apoD, apoE…
A: apolipoproteins are the proteins that bind lipids. These lipids could be in the form of cholesterol…
Q: Q2: Incomplete reduction of oxygen to water in ETC produces reactive oxygen species (ROS), - Write…
A: Macrophages perform critical roles in the start and resolution of inflammation, primarily by…
Q: II. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A:
Q: B. Consider the following types of cells and their respective conditions: i. a liver cell with…
A: Depending on the availability of oxygen, there are two types of respiration. Aerobic respiration…
Q: a. Explain how figures 3 and 5 are connected. Does this support the hypothesis proposed by Parent…
A: Resistance Resistance is defined as the ability of an organism to avoid the attack of a compound or…
Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…
A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…
Q: Question 1 Lipids from an organic sample are extracted separately using acetone (A), hexane (H), and…
A: The KHSO4 test is known as acrolein test and is used for fat or glycerol detection. Hexane extract…
Q: 12 10 00 (log) Number of species 6 A N 0 400 800 1200 Age of clade (My) Use the information in…
A: It is a study conducted by Rabosky and as per the report the answer is given: As per the provided…
Q: Examine the graph below and answer the questions provided: (a) At what point of this graph is…
A: The action potential curve in the nerve is given in the image. The graph is present between the…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: Blood pressure is measured with a sphygmomanometer. Average normal blood pressure of an adult is…
Q: Which of the following is not a characteristic of plant hormones? They are active in small…
A: Plant hormones like Auxin, Cytokinin, etc. are produced at extremely low concentrations. At very…
Q: In Brinjal eggplants, purple fruit is incompletely dominant to white fruit, with the heterozygote…
A: When a white flowering plant is about to make a cross with a purple flowering plant, the resultant…
Q: Question 9 Why are integral membrane proteins difficult to study? O They are difficult to isolate in…
A: Integral membrane proteins Proteins which are permanently bound to the lipid bilayer. They require…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi…
A: The bond between nitrogen and alpha carbon (N-Calpha) in amino acid is known as phi bond. On the…
Q: How can a UV-Vis spectrophotometer be applicable in determining the absorbance/concentration of a…
A: UV and visible radiation are only a small part of the electromagnetic spectrum, which also includes…
Q: (Heart) Which interval is the longest: a. between beginning 1st sound and end of 2nd sound? b.…
A: Heart echocardiography is quickly becoming a routine treatment technique for a wide range of cardiac…
Q: 1) Blood pressure is measured with a 2) What is the average normal blood pressure for adults? Label…
A: The heart is a muscular organ the size of a fist that sits directly behind and somewhat to the left…
Q: Match the description on the left with the correct term on the right. Some answers may not be used.…
A: Match the correct term on the right to the correct description on the left.
Q: 13) when testing the ability of a frog’s skeletal leg muscle to move, which chemical would be best?…
A: Neurotransmitters are chemicals that are responsible for transmitting signals between nerve cells,…
Q: iv) The phenotype of a double mutant, W X, is shown below. Choose the single regulatory scheme above…
A: The fundamental method to understand the process of gene expression in eukaryotes is to examine…
Q: II. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize…
A: ATP synthase This enzyme is used in the process of oxidative phosphorylation to generate ATP…
Q: 35) how epinephrine can have a depolarizing effect on one tissue and a hyperpolarizing effect on…
A: Hormones are chemical substances produced by our body's endocrine system, which releases the…
Q: Which of the following does not describe Linkia sp.? A. Ventral side is lined with two rows of tube…
A: Linckia is a genus of star fish or sea stars which are of different colors and shapes. They are…
Q: Question 31 What directly or indirectly determines the transition temperature? O the ability of…
A: Biomolecules are the fundamental building components of all living things. They play an essential…
Q: select a microbe that has proven to be either environmentally or socially beneficial to human…
A: In this question we have to describe about the useful bacteria . See full answer in step 2.
Q: acid base balance
A: Acid is a substance that is capable of donating protons. Base is a substance that accepts the…
Q: The following image shows Nondisjunction. Which of the following cells will suffer from a genetic…
A: Nondisjunction is a failure of chromosomes to separate during cell division. This results in the…
Q: In which of the following phases does this specific arrangement of chromosomes occur? No answer O…
A: 25) The given arrangements of the chromosome shows the stage in which the genetic material of the…
Q: 1. 2. 3. 4. Name (1) (2)
A: The female reproductive system includes the ovaries, Fallopian tubes, uterus, vagina, accessory…
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: The next two questions go together. Again with the llamas that display an extraordinary range of fur…
A: In this question we have to discuss about a type of epistasis. See detailed answer in step 2.
Q: How is the topic about Threats (Biodiversity & Sustainability, Climate Change and Pollution) and…
A: Threats to biodiversity as a example if we take oil spillage during crude oil extraction that used…
Q: 3. Which side of the heart pumps oxygenated blood to the body a. Left side b. Right side
A: The heart is the organ which pumps the blood to the body. The heart is the link between the lungs…
Q: Carnivorous plants: CARNIVOROUS PLANTS Carnivorous plants attract insects promising a reward of…
A: Answer :-(D) is correct.
Q: Question 4 In ducks, the allele for black feathers (B) is co-dominant with the allele for white…
A: Alleles Alleles are the two different varieties of same gene for example height is gene and long and…
Q: The amount and composition of dietary fat are important factors for influencing blood lipid…
A: Dietary fiber can help reduce blood cholesterol levels by: binding cholesterol and bile acids in…
Q: Q7. Why are Okazaki fragments formed in DNA replication?
A: The first question is answered as per the guidelines. Please put a separate question for the other…
Q: Label the columnar epithelium, reticular fibers, smooth muscle, and loose CTP of the small intestine…
A: in this question We have to describe about histology of small intestine. Sea full answer in I am…
Q: A. What is paroxysm? Describe the stages of paroxysm.
A: In this question we have to describe about paroxysm. See detailed answer in step 2.
Q: What part of the organism is used in order for it to maintain its position in its natural…
A: Introduction Crustacea:- They are any of a large group of mostly water animals with a body made of…
Q: Cancer stem cells
A: Cancer stem cells (CSC) represent malignant cell subsets in hierarchically organized tumors, which…
Q: Genetic engineering applied for generating food sources is said to be different from traditional…
A: Introduction:- By modifying the genetic composition of crops, genetic engineering and traditional…
Q: 3 advantages and disadvantages of conventional breeding.
A: Conventional breeding: Also called as classical breeding or traditional breeding. Using this method…
Q: In rabbits, short hair (S) is dominant over lang hair (s). What genotype and phenotype ratios are…
A: The cross is between two heterozygous short haired rabbits. Here s is Dominant ove S. So, Ss × Ss…
Q: 100 g www.L Larvae and pupae per Bt plant T 60 0 h J TOH -- Mosaic, Cry1Ac plant --0-- Mosaic, Cry1C…
A: Bt plant Bt plant is abbreviated for Bacillus Thuringiensis plants. These are transgenic plants…
Q: USING THE RAINFOREST get data for the following. Dominant plant and animal species Keystone…
A: Location and species found in rainforest.
Q: What is the difference between diffusion and facilitated diffusion?
A: Diffusion is a process by which particles move from higher concentrations to lower concentrations.…
Step by step
Solved in 2 steps
- Question Completion Status: A Moving to another question will save this response. Question 13 Total Magnification of a microscope is O 1. Product of Ocular Lens and objective lens magnification O 2. Sum of the ocular lens and objective lens magnification O 3 Magnification of ocular lens minus magnification of objective lens O 4. None of above Moving to another question will save this response.Please include your reference below for my further research. Thank you! 1. What are the basic components of a Fluorescence Microscope and what are the functions of each? 2. Are there any parts that you can remove without compromising accuracy and utility of the equipment? 3. Can you suggest additional components to improve the equipment?* Question Completion Status: QUESTION 67 Specimens viewed through the microscope appear: O reversed (upside down) and inverted (backwards), O smaller and inverted (upside down). O inverted (bpside down). smaller. O reversed (backwards). QUESTION 68 What are the sample holders used in the spectrophotometer called? O Cuvettes O Volumetric flasks Syringes O Pipettes O Graduated cylinders
- (ChooseI | Choose Where the slide sits on Holds the slide in place Used for making small adjustments to focus Condenses light before it goes through the sample The whole microscope sits upon this Used for moving around the stage and slide Used for making large adjustments to focus Does most of the magnification. These are close to the slide Provides light Magnifies the image, It is what you put your cycs near (Choose ChooseComparison of the different objectives of the compound microscope Point of Comparison Scanner LPO НРО O1O Degree of magnification (X) 4х 10x 40x 100x Details of the specimen (least to most detailed) Area of field of view (smallest to biggest) Brightness of image (dimmest to brightest ) Working distance (mm)ES Practice, Question 07 Select ALL the correctly described types of microscopy: Bright field commonest microscopy using visible light O Dark field/ uses UV light and spotlights specimens O Nomarski/ uses dual beam visible light with high resolution but shallow depth of field O Phase contrast/ dual beam light, contrast comes from phase changes within the specimen 1 2 13 14 15 O Fluorescence/ uses gamma rays to resolve specimen detail 16 17 18 19 20 Study MAY 24 MacBook Pro 80 000 O O O O O
- Using a Light Microscope to Determine an Object's SIZE PRE-LAB QUESTIONS Fill in the diagram of the microscope with the term or description that matches, the microscope part. Eye Plece Body Tube Contains lens to increase magnification usually 10x Revolves to allow changing various objectives Arm Objectives Moves stage up and down approximately to correct distance Hold slides in place Stage Permits finer focusing by moving the stage in smaller increments Regulates the amount of light going through the stage Base Light Source Copyright © 2012 Laying the Foundation®, Ic., Dallas, Texas. All rights reserved. Visit us online at www.lftralning.org.watch the four minute video: https://www.youtube.com/watch?v=B-nEYsyRlYo Anwer this question:What Do You See (primary or archival footage, interviews, still images, the filmmaker)?List down 5 steps in the given procedure below for the proper use of microscope that you think emphasized on proper equipment care and briefly explain why you think so in 1-2 sentences per identified step. 1. Connect the microscope to the power supply. Turn “ON” the microscope.2. Rotate the light intensity adjustment knob to adjust the brightness.3. Place the slide with the specimen facing upwards on top of the mechanical stage. a. Open the bow-shaped lever of the stage clip outward.b. Slide the specimen from the front toward the rear.c. Return the bow-shaped lever gently.d. Center the specimen over the aperture on the stage. 4. Use the Low Power Objective. a. Rotate the revolving nosepiece until the 10x objective lens is “clicked” into position.b. Rotate the condenser focus knob to bring the condenser down to the bottom and partially open the iris diaphragm.c. Rotate the coarse adjustment knob to focus the image. Move it as far as it will go without touching the slide.d. When coarse…
- Skill-Building Exercises (Question numbers refer to the numbered steps in the actual lab.) Finding the object 1. Letter "e" as it appears to unaided eye: 3. Letter "e" as it appears in microscope (total magnification 40 x)https://kccd.instructure.com/courses/78250/files/13719143?verifier=6qbmxBntMxenTj1KsGr0vHWbaeQGAY9IIklLczrO&wrap=1 Please answer in detail for each part of question 2Using the microscope Answer the following questions as you work through this exercise: 1. How is the letter “e” on the slide oriented when you see it with the naked eye as you mount it on the stage (i.e., is it right side up or upside down)? 2. How is the letter “e” on the slide oriented when you see it under low or high power magnification? 3. What effect, if any, does the compound light microscope have on the orientation of the image?