Methanopyrus kandleri is an organism that lives in a hydrogen-carbon dioxide environment and discovered in a hydrothermal vent where temperatures reached 230°F. In which dassification can you include this organism?
Q: What explanations can account for the following pedigree of a very rare trait? Be as specific as pos...
A: The pedigree analysis helps us identifying the mode of inheritance of a particular disease by observ...
Q: The effective-refractory period present during Phase 2 of the action potential of ventricular myocyt...
A: A transient shift in membrane permeability across the cellular membrane of cardiac cells is known as...
Q: STRUCTURAL SIMILIRATIES WITH OTHER ORGANISMS MILKFISH SALAMANDER SNAKE EAGLE POLAR BEAR
A: All these mammals have some basic characteristics in common.
Q: A eukaryotic gene is added to a mixture containing a restriction enzyme EcoRI and a bacterial plasmi...
A: The restriction endonuclease is the enzymes that help in the deduction of the DNA from a specific se...
Q: (1) The initial action potential would have the membrane be depolarized - which is due to the influx...
A: Note- as we are allowed to do one question at a time. I can provide answer to the first question onl...
Q: What are the main elements of Darwin's theory of evolution?
A: Introduction :- Natural selection, according to Charles Darwin's theory of evolution, is how evoluti...
Q: 30- Which of the following is true about muscle contraction: a- Results by the actin sliding along m...
A: Muscle contraction us the tightening , shortening or lengthening of muscles when you do some activit...
Q: Describe the fate of the λ phage during the infection process with mutants in the following genes: ...
A: Bacteriophages are a large category of viruses with a wide range of characteristics. DNA or RNA can ...
Q: What is the difference between sequential and concerted assembly? Herpes viruses sequential assembly...
A: Flu Viruses (Influenza) Flu infections have a place with the Orthomyxoviridae family and are named...
Q: QUESTION 34 Hormones are cleared from the blood by metabolism in the O Jungs, brain and and excreted...
A: The above given statement is about hormone function in the body.
Q: which statement is false? a. Electrons do not usually flow through the electron-transport chain to...
A: Oxidative Phosphorylation: The metabolic route in which cells use enzymes to oxidise nutrients, rel...
Q: Which of the following scientific names shows correct usage of binomial nomenclature? Group of answe...
A: Introduction Binomial nomenclature:- It is the biological system that is used to name an organism, I...
Q: Importance of the new discovery about prokaryotic cytoskeleton's structure and function.
A: Cytoskeleton is network of fibers forming infrastructure around cell.
Q: Why are recombinant DNA technology and nucleus transplantation technology still dangerous?
A: Recombinant DNA technology It refers to the combination of DNA molecules from two different species....
Q: True or false? Inbreeding can increase the frequency ofa harmful allele in a population’s gene pool
A: Inbreeding is a process in which two closely related organisms which are related through common ance...
Q: Identify the number of chromosomes in a typical human GERM cell during each stage of meiosis. For ea...
A: Answer :- The number of chromosomes in a typical human GERM cell during each stage of meiosis :- * ...
Q: 4. Put the following steps of the ELISA assay in order (Write the numbers 1-4 in the blank): Add Ant...
A: Introduction: ELISA stands for Enzyme Linked Immunosorbent Assay. It is a commonly used laboratory t...
Q: Explain the three most common types of endocrine pathologies. Make sure you clearly - identify hypo...
A: Diabetes mellitus (low pancreatic insulin release is observed in such case) acromegaly (hyper-secret...
Q: D Test =4.23; HSD[.01]=5.36 nonsignificant M1 = mean of Sample 1 M2 = mean of Sample 2 and so forth....
A: Since the researchers need to compare that how has the drug affected the population and do the compa...
Q: Predict gene frequencies in populations when one allele is favored over another. Predict effect of c...
A: The calculation of gene frequency needs to detect the degree of dominance between alleles like compl...
Q: Which of the following is true about lafge receptive fields? O Many primary sensory neurons converge...
A: The term receptive field is given by neurophysiologist Sherrington in the year 1906. The body parts ...
Q: What do you think will happen to the accumulated lead metals of the plants after a successful phytor...
A: Phyto remediation is the process by which plants are used to removes pollutants in the soil. The pla...
Q: What is tej role of indigenous knowledge in the development of indigenous science?
A: Answer
Q: Record the genotypes for pea plants with the following descriptions: A. A plant with yellow pods: B....
A: Genes determine traits such as color, shape, height, and each gene is governed by two alleles, each ...
Q: In your own words, explain why Nucleus is considered the Control Center of the cell.
A: Introduction The Cell is the smallest basic unit of life unit that can live on its own and that make...
Q: Put the numbers of the cell pictures in the correct order to show the sequence of stages in meiosis....
A: 1. Anaphase 1 2. Anaphase 2 3. Prophase 1 4. metaphase 1
Q: Which of the following would be classified as non-coding DNA? (mark all applicable answers) The cyto...
A: Non coding DNA are sequences of DNA that do not code for proteins.
Q: What is the main moral problem regarding the cloning of human individuals?
A: Introduction In this question we will discuss about the main moral problem regarding the cloning of...
Q: Give at least two other examples of samples that are best prepared using Smear Preparation Technique...
A: Smear preparation technique: it is used to fix the samples onto the slides.
Q: One molecule of NADH results in the production of 3 ATP molecules because: a. NADH contains 3 hydro...
A: NADH It stands for nicotinamide adenine dinucleotide + hydrogen. It's an important part of the red...
Q: 3- a muscle contracts more forcefully if: a- its motor units contracted simultaneously. b- the amoun...
A: Muscle contraction is regulated through the the function of alpha motor neuron/lower motor neurone w...
Q: condon chart transcribe then translate Gene 1 Lactase Enzyme variation 1: lactose Intolerant dna:...
A: The transcription is the process that involves production of RNA from the DNA template while transla...
Q: What is genetic equilibrium?
A: Generic equilibrium is the result of the Hardy-Weinberg law, which is a scientific principle stating...
Q: 15- the membrane potential if the [Na+] outside, inside = A. (+) B. (-) C. (+) D. (+)
A: Depolarization occurs when sodium ions enter inside the cell. This changes the membrane potential.
Q: 47- Damage of motor neuron cortices on the left side of brain will cause: a- Left flexor muscles to ...
A: Introduction: The cerebral cortex of the brain has three regions of function, namely Sensory, motor ...
Q: With regards to small pox disease,describe the difference between variolation and vaccination and ex...
A: Variolation was an earlier approach used for immunisation against smallpox disease( variola). It inc...
Q: Evolutionary Thought: answer the question in essay form. write your reaction/reflection about the M...
A: The Modern Synthetic Theory of Evolution that is also called Modern Synthesis. It merges the concept...
Q: In Human Cell at Difference Stages of MeloSIS Identify the number of chromosomes in a typical human ...
A: Meiosis is a kind of cell division that produces haploid daughter cells.
Q: Select physiologic factors of the ventilation-aeration system that limit VO2max and aerobic performa...
A: VO2 (or oxygen consumption) is a measure of the volume of oxygen that is used by your body to conver...
Q: Which kingdom do decomposers such as molds and mushrooms belong to? Group of answer choices plantae ...
A: INTRODUCTION Kingdom fungi This is a group of Eukaryotic microorganisms including yeast, moulds as w...
Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongatio...
A: Translation Translation involves the answer of information in mrna molecules into the amino acid seq...
Q: 14. DNA methyltransferase, an enzyme that methylates DNA, ----. a. is expressed in a higher than nor...
A: The division of a parent cell to form daughter cells is a normal body process that occurs in cycles ...
Q: QUESTION 1 Match each term with its correct description +Anatomical sex A. A persons sense of themse...
A: The correct matches are written before each terms in below table.
Q: One of the following diffusion paths is not driven by the concentration of sub: a- Primary active tr...
A: Active transport uses energy for the transport of solute, whereas passive diffusion and simple diffu...
Q: Which observation is NOT an evidence for Darwin's theory of common descent? O There are biogeographi...
A: Darwin's theory of evolution states that individuals of species are not identical. It also states th...
Q: Using the information on the box provided, which of the following statements is true? First Second T...
A: According to Hardy Weinberg equilibrium, the sum of allelic frequency , p+q= 1. And the frequency re...
Q: Regarding the detection of the head tilt: a- When one receptor is excited at one side, the other is ...
A: According to the question, we have to confirm what events happened when the head tilt is detected. T...
Q: Keep answers, short, simple, and concise. No detail required. Is ATP produced during the light ...
A: The photosynthesis is the process that involves production of carbohydrates (glucose) by using energ...
Q: Restriction mapping of the delta chromosome I need help with question two please
A: the mean size is close to 4000 bp. DNA fragments of this length are useful in the lab, since theylon...
Q: Explain how cyclin D-CDK 4/6, Rb and E2F work in the presence of growth factor to get the cell progr...
A: Cyclin CDK 4/6 are the cyclin-dependent kinases that help in moving the cell from the G1 phase to th...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Methanopyrus kandleri is an organism that lives in a hydrogen-carbon dioxide environment and discovered in a hydrothermal vent where temperatures reached 230°F. In which classification can you include this organism? Group of answer choices archaea bacteria fungi protistA microbiologist identifies a bacterium that is capable of degrading cellulose, lignin, chitin, latex, aromatic chemicals, and keratin. It produces metabolic byproducts that give soil a musty smell as well as some that can be used as antibiotics. Which of the following genera is being described? View Available Hint(s) for Part A Pseudomonas Campylobacter Neisseria StreptomycesKarelina Bologicel Supply Company Give the DOMAIN for these organisms
- You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTErythromycin, an antibiotic discovered in 1952 from soil bacterium Saccharopolyspora erythraea, was discovered by a Filipino scientist Abelardo Aguilar. Using schematic diagram, outline the process that led to thisOne of the types of structures on this list is NOT part of the reproductive cycle of a microbe. Identify that one. bacterial spores fungal spores yeast buds protozoal cysts
- According to the article, which type of microbes thrive in dirty/wet environments? Question 5 options: protists gram positive gram negative & fungi all of theseBiofilm is O Multicellular organisms Single cell Colonial organism O O OIdentify the best taxonomic category that best describes the prokaryote in the given scenario. Archaeans living in a hydrothermal vent was cultured on the vent itself. Group of answer choices Thermophile Methanogen Halophile Psychrophile
- QUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTwhat makes areobic or presence of oxygen conditions good for bacteria to growTHIS IS A MULTIPART QUESTION, PLEASE ANSWER ALL QUESTION Using the image: 5. Identify whether the organism is a green alga, a diatom, a dinoflagellate, Eubacterium, or a Cyanobacterium. Explain the characteristic(s) that led you to that identification. 6. a. What type of microscopy (brightfield, darkfield, or phase contrast) was to obtain the image? Explain how you can tell. b. Name a different type of microscopy would be also appropriate to use to visualize the organism in the image. How would the image change if you used that type of microscopy instead? 7. The image was taken using a microscope that has 10X, 40X, and 100X objectives. What is a possible magnification for the ocular lens on this microscope? Explain your response or show calculations.