Lare the basic unit of classification. species genus family order When the seasons change, animals such as geese, salmon and whales find a new place to live. * elsewhere to camouflage fly migrate hunt Who wrote the book with the title Voyage to Beagle?

Q: Corn has a chromosome number of 2=20. Supposing there are different aneuploidy/polyploidy in corn, p...

A: The sex chromosomes decide an individual's sex. The majority of people have two sex chromosomes, one...

Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are thes...

A: DNA is the basic hereditary molecule that is responsible for passing on genetic information from one...

Q: 23. Which of the following is correct? a) Monomer: Glucose Disaccharide: Glycogen Polysaccharide: Su...

A: Answer 23: Carbohydrates are the sugars that are rich sources of energy. Energy is extracted from su...

Q: Explain how the body returns blood glucose levels to normal if it gets too low. Include the roles of...

A: Glucose homeostasis is the mechanism by which body maintain its normal glucose level two organ play ...

Q: Individuals of genotype AaBb were mated to individuals of genotype aabb. One thousand offspring were...

A: Individuals of genotype AaBb were mated to individuals of genotype aabb. One thousand offspring were...

Q: Some plants contain compounds that inhibit serine proteases. It has been hypothesized that these com...

A: Introduction: Tofu, which is also sometimes called tofu cheese is a soya product.

Q: plant begins the process of photosynthesis with 50 kCal worth of light energy, how much energy will ...

A: The question is related to 10% energy law.

Q: Summarize the water issue concerning the Catawba River

A: *Catawba River basin is present in the  North Carolina. *This lake is located in  3,305 square miles...

Q: Genes A and B are 6 map units apart, and A and C are 4 map units apart. Which gene is in the middle ...

A: Centimorgan is also known as a map unit is a unit for measuring genetic linkage. It shows the distan...

Q: 1. List down 2 advantages and 2 disadvantages of wet mounts in stool examination

A: Wet mount test (in stool analysis) : In the wet mount test of stool analysis theProtozoan trophozoit...

Q: Can wearing a mask, limiting public spaces capacity, and having travel restrictions be justified bec...

A: Covid 19 (Coronavirus disease 2019) is an infectious viral disease caused by SARS-CoV-2 (Severe Acut...

Q: F1

A: Phenotype-the ratio of offspring manifesting a particular trait. F1-the first flial generation seeds...

Q: What is the bearing of the following factors in establishing a taxonomic character: (a) numbers, (b)...

A: In biology, taxonomy is the scientific observation of naming, defining, and classifying corporations...

Q: What is the application of electrical application in Cell Membrane potential gradient?

A: A cell membrane separates all cells from their surroundings. The cell membrane controls what enters ...

Q: elaborate on the relationships between the three germ layers in forming the mouth and facial structu...

A: The three main layer of body parts are ectoderm ,mesoderm and endoderm . We know that mouth is prese...

Q: The ADP/ATP carrier, which exchanges cytoplasmic ADP and mitochondrial ATP, can also function as a p...

A: Answer :: a) Proton pumping rate, electron transport rate, rate of oxygen uptake : remains the same ...

Q: A 5-month-old girl is brought to the emer- gency department by her parents because she is "turning b...

A: This is a classical presentation of a congenital heart disease known as the Ventricular Septal Defec...

Q: Can you help me to explain these dna model

A: DNA( Deoxyribonucleic acid) is a molecule that carries all the information from one generation to th...

Q: State the law of independent assortment in modern terms.

A: Introduction :- According to Mendel's law of independent assortment, alleles from two (or more) diff...

Q: Identify the method of sterilization/ chemical agent described At 15psi, the temperature reaches 12...

A: Given information: At 15psi, the temperature reaches 121 degree Celsius requiring only 15 to 20 minu...

Q: The long hair of Persian cats is recessive to the short hair of Siamese cats, but the black coat col...

A: Introduction  A gene is consisting of a pair of alleles/factors and can be dominant or recessive. A ...

Q: Explain the environmental issues that would most likely arise from the water transfer.

A: Water transfer can be divided into several categories. One of the categories include alteration in r...

Q: Туре Formula Chromosome number and Chromosome Complement 7: (АВCD)(ABC) 6: (АВC)(АВC) 6: (ABCD)(AB) ...

A: In meiosis Diakinesis is the last step of prophase. prophase is the longest step of meiotic division...

Q: What is a continuum of strategies (in ecology)?

A: The continuum of life-history refers to the growth, reproduction and death of organisms in a given b...

Q: A trihybrid individual with the genotype QqRrTt is testcrossed with a qqrrtt individual. The resulti...

A: A trihybrid cross is a cross between two individuals of the same species for the purpose of studying...

Q: Compare the Peak Respiratory Flow of men vs women provide exmaples

A: "ANSWER  When comparing males and females, males have higher specific airway conductance and flow r...

Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...

A: Egg white It refers to the clear liquid present inside the egg. It is formed from the layers of secr...

Q: Illustrate the Parental and F1 cross

A: Trihybrid cross is between the two individuals of a species for studying inheritance of three pairs ...

Q: Stomach 4x or  10x label lumen , simply columnar epithelium gastric pits mucosa layers , submucosa m...

A: Introduction: Stomach is a J-shaped muscular, bag-like organ of the digestive system. It is located ...

Q: For each of the statements below, state whether the statement is true or not, and provide a detailed...

A: Introduction: Agonist: A substance that acts like another substance and therefore stimulates an acti...

Q: A can cleave the hinge of each heavy chain as shown below.

A:  IgG is cleaved with a protease that is the one which targets the hinge region. Proteolytic cleavage...

Q: INTRUCTIONS: Place a check on the box if the organ/structure is present in billy goats/bucks. Leave ...

A: Male reproductive system of bucks The male reproductive system consists of testicles,which produce s...

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: All genes regulated by PKA contain a cis-acting DNA sequence that binds to the phosphorylated form o...

A: PKA-promoted protein phosphorylation has both transcriptional and posttranscriptional results. The f...

Q: A solute cannot move into a cell by crossing the phospholipid bilayer of the membrane. It can, howev...

A: Plasma membrane is a bilayer structure composed of phospholipids that has different proteins embedde...

Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans: TTACACTTGCTTGAGAGT...

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for you...

Q: Create a flow chart on how to prepare a nutrient agar

A:                                                                      Nutrient Agar            ...

Q: There are two groups of drugs classified as antagonists of histamine receptor antagonists. The one g...

A: The drug : histamine receptor antagonist Two groups of the drug:  Blocks activation of histamine2 (...

Q: A 49-year-old male was brought to the Emergency Department for evaluation of nausea, fatigue, and we...

A: The patient has the following abnormalities which need immediate medical attention: - Hyponatremia ...

Q: Disorder of Sex Determination Now that you have reviewed typical sexual determination in humans, it ...

A: Swyer syndrome  It is an uncommon disorder that causes the sex glands (testicles or ovaries) to fai...

Q: Photosynthesis is defined as the chemical process, wherein carbon dioxide in the presence of water a...

A: The plants have three basis needs to grow better. These are, 1) Sunlight 2) Water 3) CO2 Along with ...

Q: hemoglobins interact with hemoglobin S and how can these be differentiated from hemoglobin C

A:

Q: Assume that D, E, F, G, H, and I are autosomal genes on different chromosomes. From the mating (pare...

A:  Every diploid organism have 2 copies of each  chromosome i.e 2 homologous chromosomes present ( one...

Q: How can widely separated parts of a protein interact with the spike protein

A: Sharp bumps emerge from the surface of the outer envelopes of members of the coronavirus family. Spi...

Q: Independent assortment means .a. alleles at one locus assort into different gametesb. alleles at dif...

A: Introduction  Sir Gregor Mendel is known as the Father of Genetics. He was the pioneer scientist who...

Q: What do you think would happen to the mouse population if the number of fox predators, such as wolve...

A: Nothing will happen according to the options available in the question.

Q: 18. Where is the energy stored in ADP7 Between the first and second phosphate bond b) Between the se...

A:

Q: QUESTION 2 Cotransporters... UA Do NOT hydrolyze ATP UB: Include symporters that move ions in the sa...

A: Co-transporters are the membrane carrier proteins comes under secondary active transport of substanc...

Q: a far point of 5 m. Spectacles that enable them to see distant

A: Optical power is the degree to which a lens,mirror or other optical system coverages or diverges lig...

Q: Can two people have the same DNA?

A: DNA is a molecule which is the genetic material of a cell that has all the information of a particul...