It is obtained from the milky secretion of various plants such as the tree Hevea brasiliensis. Select one: a. PAI b. Xenoy c. natural rubber d. collagen
Q: 4. General characteristics of water-soluble vitamins as components of human nutrition.
A: Vitamins are the organic compounds required in the diet in small amounts, for performing biological…
Q: a. The importance of recombinant DNA technology in Environment b. Potential products…
A: DNA : Deoxyribo nucleic acid. It is a polymer which is composed of two polynucleotide chains that…
Q: 2. Aspirin can be absorbed into the blood through the cells lining the stomach and the small…
A: Aspirin is a drug that is used to reduce pain, antiinflammation, and fever. Aspirin is chemically…
Q: Which of the amino acids does NOT have an aliphatic side chain? a. Lysine b. Alanine…
A: R groups in aliphatics are nonpolar and hydrophobic. The hydrocarbon chain's hydrophobicity rises as…
Q: 2. Biuret Test Color of 3% CuSO4 solution: Sample casein alanine albumin gelatin distilled water 3.…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: Describe the process of denaturation of protein.
A: The proteins are most active in their native structure. Native conformation of the protein is the…
Q: For the enzymes involved in producing ATP at an extremely high rate, please indicate the products…
A: ATP (adenosine triphosphate) is the energy currency that the cell uses in metabolic transactions.…
Q: Consider the peptides Pro-Gin-Val-Phe-His-Asp-Cys and His-Gln-Pro-Cys-Asp-Phe-Val. How do these two…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: You have discovered a new species of plant. You isolate chromatin from the plant and examines it…
A: Histones are basic proteins that are rich in basic amino acids like arginine and lysine. These basic…
Q: 1. What is the sequence of the heptapeptide produced upon treatment with trypsin? Fill each blank…
A: Specific enzymes have specific cleavage point in amino acids. Chymotrypsin is serine…
Q: actate dehydrogenase is a tetramer of MW 134000 g/mole composed of subunits which are equal in size.…
A: Lactate dehydrogenase belongs to the family of oxidoreductases. It catalyzes the conversion of…
Q: 14) Which of the following statements is true under the conditions provided: the enzyme…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Draw the Biosynthesis of fatty acids from Acetyl CoA pathway and identify the different types of…
A: The biosynthesis of fatty acids from the acetyl-CoA occurs in the cytosol. It involves the addition…
Q: Which of the following would you expect to happen if amino acids 579 to 582 (YIYV) in the PDGF-Beta…
A: PGDF beta-receptor contain multiple domains that activate the various pathways inside the cell. The…
Q: Vancomycin is a very potent antibiotic use for several diseases such as infective endocarditis,…
A: Vancomycin is a unique glycopeptide that is structurally unrelated to most common antibiotics. This…
Q: What is the net ionic charge for the peptide at pH 5 and pH 11? The peptide is…
A: A peptide is a short chain of amino acid residues linked via a peptide bond. As a general rule of…
Q: Proteins in/on target cells that bind messenger molecules and cause a response in the cells are…
A: Proteins are made up of amino acids which are used as a monomer unit of proteins. 22 standard…
Q: Count Experiment Name: Specimen Name: Tube Name: Record Date: SOP GUID Display Range Population P1…
A: The flow cytometry data in the given image uses BV-605 as the fluorescent molecule. From the…
Q: Need help, please.
A: Malate dehydrogenase is an enzyme that catalyzes the final reaction of the TCA cycle. In the first…
Q: ATP is deemed the Universal currency for Cell, why do you think now it is the Fact
A: Energy-rich compounds are chemicals with specific structural characteristics that cause an energy…
Q: Qualitative Color Reactions Color Reaction Biuret Ninhydrin Xanthoproteic Millon's Intact Protein…
A: Hi! Thank you for the question. We are authorized to answer four subparts at a time, since you have…
Q: Glycolysis Glucose Pyruvate Pyruvate Oxidation Citric Acid Cycle Oxidative Phosphorylation (electron…
A: Introduction Cell requires energy for the various activities. Cell gets energy by cellular…
Q: 6. Analysis of Buffers in Unknown Solutions Imagine that you are given three different solutions:…
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: At a pH of 10, would you expect this peptide to be retained for a longer time within an anion…
A: Ion exchange chromatography separates molecules based on their charge difference. A cation exchange…
Q: The net yield of ATP for the complete oxidation of one molecule of glucose is O 10 ATP O 24 ATP O 30…
A:
Q: What is the product of the beta oxidation of this fatty acid?
A: The given fatty acid is caproic acid. Beta-oxidation is the oxidation of fatty acid on the…
Q: what 3 types of lipids exist? Give an example of each.
A: Introducion Lipid is a biomolecule consists of carbon, hydrogen, and oxygen. Lipids are water…
Q: draw all the structures of the tribasic amino acid lysine involved in the equilibrium reactions that…
A: The proteins are composed of 20 naturally occurring amino acids. The amino acids can be classified…
Q: What is the subject of the figure: What is the main message of the figure? Give a concise, complete…
A: Subject of the figure is point mutation of a base which leads to different translated product of a…
Q: The word root erythr/o means? Don't copy
A: The identification of affixes in biological terms can help in the understanding the complex terms.…
Q: Discuss why fluoroacetate can be called a mechanism-based inhibitor. what is a mechanism based…
A: Introduction Enzymes are known as bio-catalyst. They increases the rate of a chemical reaction by…
Q: In the absence of oxygen is glucose the major source of ATP?
A: It is generally agreed upon that ATP serves as the mediator of energy transfer between anabolism and…
Q: is albumin a macromolecule? if yes which type?
A: The biological macromolecules can be divided into four classes: the nucleic acids, the proteins, the…
Q: Provide a detailed plan and explanation on how to synthesize the following peptide by using Fmoc-…
A: Solid phase protein synthesis is a very powerful technique for the generation of synthetic oligo…
Q: Identify the oxidizing and reducing agent of the given equation: Answers should be the symbol of the…
A: An oxidising agent is a substance that gets reduced in order to oxidise other substance. A reducing…
Q: What is a codon, how many RNA nucleotides are in a codon, How many of these code for amino acids,…
A: Transcription is the process by which the genetic information stored in the DNA is copied onto an…
Q: Which one is not an example of supersecondary structure? the pyrrole ring O the Greek key the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 5. Bread contains mixture of polypeptides known as gluten. This polypeptide has two types which are…
A: The folding of a polypeptide chain into a three dimensional folded conformation can be divided into…
Q: 8. Phosphate buffered saline (PBS) is often used as an isotonic solution to keep cells happy and…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: Which of the following statements concerning SDS in SDS-PAGE is INCORRECT? a. SDS is a negatively…
A: SDS-PAGE is an electrophoresis technique used to separate protein molecules. Protein molecules can…
Q: The graph is an example of the rate of product production by an enzyme when the substrate is in…
A: An enzyme has substrate binding site. When substrate binds to that site, the reaction takes place.…
Q: The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine…
A: Alkaline hydrolysis is a process by which RNA is degraded dur to attack of -OH ions of alkali. The…
Q: The Worthington's manual reports two extinction coefficients for lysozyme. Corvert one into the…
A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Draw the Catabolism of triacylglycerols- beta-oxidation Pathway and identify different types of…
A: Fatty acids are transported into the cell. The enzyme fatty acyl-CoA synthase(FACS) adds a CoA group…
Q: 4. What effect do the presence of other materials in a mixture have on the Rf of a specific…
A: Chromatography is a biochemical technique that is used to separate a mixture of substances. In this…
Q: Even though HbA is a heterotetramer (not all the subunits are the same), the alpha- and beta-globin…
A: Haemoglobin is a carrier protein that carries oxygen to the cells . It is present in red blood cells…
Q: Select the answer with an INCORRECT statement about the hydrophobic effect It is important for…
A: Hydrophobic effect is the tendency of non polar molecules to interact with each other in polar…
Q: Draw and name an aldose and ketose having five (5) carbon atoms. Identify in your drawing the point…
A: Carbohydrates are a class of macromolecules that plays an important role as energy source for the…
Q: True or False: Phosphoryl groups are added to enzymes to increase their activity. *If this…
A: The enzymes are biological catalysts that are mostly protein in nature. The activity of an enzyme…
Step by step
Solved in 2 steps
- Write the procedure for epoxy embeddingMatch between groups A and B: A Pectin Prepared gums Habitual constipation Natural gums Saponins Waxes Secondary metabolite Volatile oils Treatment of burns Shikmic acid Dextrins Cardiotonic Primary metabolite mevalonic acid Red squill Poisonous Flavonoids Senna White squill AloeYou are preparing to give a drug by the transdermal route to a patient. Which safety precaution should you use when giving this type of drug? Select one: a. Always wear gloves when giving transdermal drugs. O b. To maintain blood levels, apply alcohol to the skin. O c. Remove all patches before showering. d. Keep all prior patches on the skin
- You have received a call from a person wishing to feed their weaned growing beef calves a byproduct of the hemp industry—they have access to 4T and it is free. After the oil is extracted from the hemp for CBD, a white powder remains. They wish to know if they can feed the powder and how much then can feed. The powder is about 48% digestible, is 20% NDF, 12% ADF and has a CP content of 25%. The ash content is 20%. Discuss step by step your approach to finding the answer for the producer.Gelatinase Liquification or no change: _____________________________ Gelatinase produced, +/-: ____________________Make a concept map/flow chart for this technique (Cellulose Tape Perianal Swab)
- The term “fiber” has several meanings with regard to textiles. Briefly describe bast fibers, soft fibers, hard fibers, and wood fibers. Give an example of each.Name the method based on a conception, that the diminishing of toxic substances quantity in the stomach and intestine by the adsorption on a surface of a sorbent Select one: a. enterosorption O b. lymphosorption c. hemosorption O d. application sorption O e. plasmosorptionwrite the procedure for the following a. celloiding embedding b. epoxy embedding c. vacuum embedding
- Nutmeg contains all sorts of phytochemicals including phenolics, flavonoids, carotenoids, alkaloids, lignins and terpenoids. Since it can treat psychological disorders, how can it be used? O It can treat skin infections It helps lessen flatulence, colic, indigestion and diarrhea As a substitute for marijuana O It can treat tumorsAll of the following essential oils are suitable for chronic pain except: Choose one answer. a. grapefruit b. verbena c. ylang ylang d. lemongrassTo print a medical scaffold made out of TPU to surgically implant around the pancreas for diabetic patients can you explain why Bio Printing the scaffold is better than SLA and which materials would be best to use for Bio priting out of collagen, fibrin or silk. What are the advantages and limitations of SLA and Bioprinting.