It is gram-negative, nutritionally diverse (Photoautotroph, Photoheterotroph, Chemoautotroph, or Chemoheterotroph), and can be a pathogen or form symbioses. What group does it belong to? Group of answer choices Spirochetes
Q: 1. Mutation, as a genetic evolutionary force is: a. A strong evolutionary force b. A weak evolut...
A: * Mutation means a small alteration in a DNA sequence. *Mutations arises dut to mistakes and errors ...
Q: what can we do to help reduce the amount of pollutants such as CO, SO2, NO2, HCl, NO3 in the atmosph...
A: The environmental change includes elevation normal temperatures as well as outrageous climate occasi...
Q: Non-oxidative processes for ATP regeneration are only employed in anaerobic exercise O True O False
A: In anaerobic metabolism lactic acid is produced which is during intense activity ATP regeneration o...
Q: Mutation identity- GLY Outline the effects the mutation will have on the 3D structure and function ...
A: A mutation is a change in an organism's DNA sequence. DNA is the genetic material of the cell, and i...
Q: Lactating mammals produce which two hormones that promote milk synthesis and milk release? prolactin...
A: ANSWER) Prolactin and Oxytocin are the hormones which are responsible for the production and release...
Q: An infertile female cattle with masculinized behavior and non-functioning ovaries, is known as steri...
A: Note: As per Bartleby Guidelines, For Remaining Answers Please Repost The Question. Introduction: Ca...
Q: Critically evaluate the technique of serial dilution and state some error risk as well as give recom...
A: Serial dilution is a technique in which a test tube containing the inoculum is diluted by a factor o...
Q: Consider the CT/CGRP example of alternative splicing. Which different types of alternative splicing ...
A: Alternative splicing is a technique that allows messenger RNA (mRNA) to control the production of ma...
Q: DNA from a strain of Bacillus subtilis with genotype a+ b+ c+ d+ e+ is used to transform a strain wi...
A: Co transformation means that the two genes are transformed simultaneously. Is two genes are co trans...
Q: Define about ubiquitin ligases ?
A: Enzymes have a role in catalysing the many metabolising activities in the human body. Enzymes are cl...
Q: List three reasons why biodiversity conservation is important.
A: Biodiversity refers to all the living organisms that are present in an area. It includes all the mic...
Q: Below is a figure representing DNA replication. One end of the DNA is labeled; given this informatio...
A: * DNA replication is a process in which double stranded DNA molecule is copied and hence produce tw...
Q: Where is CSF usually obtained for examination and explain why.
A: Cerebrospinal fluid (CSF) is a clear, colourless bodily fluid found in the tissue that surrounds all...
Q: Aldosterone travels throughout the body through the circulatory system. Why is it that only a small ...
A: Introduction: Zona glomerulosa is the outermost layer of the adrenal cortex in the adrenal gland and...
Q: Many of the organisms we learned about go through alternation of generations. Which of the following...
A: The organ systems work together to make whole organism. The organism can be haploid or diploid on th...
Q: Explain about RNA-induced silencing complex (RISC) ?
A: The RISC is expanded as RNA-induced silencing complex. This is referred to as a multiprotein comple...
Q: Explain on Procurement and compliance for the topic describe below: the topics of focus will be ...
A: Vaccines: Vaccines are injections liquids, pills, or nasal sprays that you take to teach your body's...
Q: What is proteasome ?
A: The proper folding of the proteins is essential for the functioning of proteins. Proteins become ina...
Q: 1.The zone of the earth that is divided into rigid plates is the: a.atmosphere b.lithosphere c.tecto...
A: lithosphere The covering and the upper layer of the mantle together make up a zone of unbending, w...
Q: What feature of procollagen synthesis provided early evidence for the Golgi cisternal maturation mod...
A: Procollagen is typically found in the lumen of the endoplasmic reticulum. It is co-translationally s...
Q: How does the processes of cellular respiration impact the global carbon cycle? Group of answer choic...
A: Cellular respiration involves metabolism of glucose in the presence of oxygen (aerobic cellular resp...
Q: How do you know if you have a ‘countable’ plate when doing a dilution series? Two plates receive...
A: The concentration of stock solution can be calculated by first diluting the stock into a suitable co...
Q: Determine what amino acid will be formed from the given DNA strand below: ...
A: Determine what amino acid will be formed from the given DNA strand below: 3...
Q: How do we know that small noncoding RNA molecules canregulate gene expression?
A: A non-coding RNA is a kind of RNA molecule that is not translated into a protein. The DNA sequence f...
Q: What is the second greatest known cause of amphibian declines, after habitat loss?
A: One of the major cause is the habitat loss. Along with this the causing of disease as well as change...
Q: Two species of bird live in the same tree. Seeds only grow at the tops of the tree and insects only ...
A: As in the given condition there are 2 species of birds living on a same tree, but actual site of liv...
Q: Many viruses that infect eukaryotic cells express genes that alterthe regulation of host gene expres...
A: Cluster of microRNA (miR)183 This miR family, which consists of miRs-183, -96, and -182, also is a ...
Q: Examining how populations lead to new lineages that arise based on alterations to allelic frequency ...
A: Evolution is defined as the change in trait of individuals over a period of time.
Q: All snowmen melt except for those affected by the non-melting recessive sex linked trait. Seth Snowm...
A: Given that, Dominat trait - Melting So,genotype of Melting - MM Recessive trait - Non-melting So th...
Q: ria reproduce b
A:
Q: The proteasome is a multi-subunit machine that unfolds anddegrades proteins. How is its activity reg...
A: The proteasome is an exceptionally refined protease complex intended to complete particular, effecti...
Q: Which statement is accurate? Hormones that differ in effect reach their target cells by different ro...
A: Hormones are released from ductless glands called the endocrine glands into the bloodstream that rea...
Q: QUESTION 1 Glucocorticoids: promote the immune response promote the release of fatty acids increase ...
A: Glucocorticoids (GCs) are steroid hormones widely used for the treatment of inflammation, autoimmune...
Q: In what ways are Leishmania differ from Trypanosoma?
A: Leishmaniasis and trypanosomiasis are separate groups of arthropod-borne diseases. They both belong ...
Q: Insulin is a protein secreted by the beta cells of the pancreas into the blood. Which of the followi...
A: Insulin is a hormone which is released by Beta cells of pancreas. And in the given options,option 1 ...
Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC CGTAC...
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other creature...
Q: 6. Which statement is incorrect for the pathogenic= spirochetes? A Stain well with Gram stain reagen...
A: For the first time in history, spirochetes contain endocellular flagella (axial fibrils, also known ...
Q: If a mutation occurs in an embryonic stem cell that alters cell proliferation there is potential for...
A: Stem cells are undifferentiated cells that have potential to develop many different types of cells i...
Q: describe the usual role of salivary and pancreatic amylase in digestion : identify reactant : ...
A: * Amylase is an digestive enzyme helps in digestion. *Amylase enzyme function is to hydrolyze starch...
Q: Describe the three basic steps in the formation and fusion of autophagosomes.
A: Autophagosomes are double-membraned vesicles that contain cellular material slated to be degraded by...
Q: Question 5 Voles and lemming are found throughout the Arctic. Which of the following statements is c...
A: Voles and lemmings These are widely spread across the Holarctic. They are located in temperate North...
Q: How do toxic substances travel through the environment, and where are they most likely to be found? ...
A: Introduction There are certain chemicals that are toxic to mankind like they can cause some adverse...
Q: QUESTION 1 Growth factors: are produced by the posterior pituitary stimulate bone and cartilage grow...
A: Growth factors: it is usually proteins in nature. These natural compounds play important role in cel...
Q: Label the nucleus, cytoplasm, and cell membrane of the following pictures. The red one is the human ...
A: Introduction: Erythrocytes in humans are produced in the bone marrow and the average life span of an...
Q: What is the arrangment of the bacteria seen in this microscopic slide? O staphylobacilli O staphyloc...
A: Streptococci or staphylococci are spherical-shaped bacteria while diplobacillus are rodshaped bacter...
Q: the hypothalamus
A: The posterior pitutary produces two hormones, vasopressin and oxytocin. Vasopressin is also known as...
Q: Question 2 Why do small Arctic mammals enter hibernation whereas larger mammals stay active during t...
A: Hibernation is defined as the process in which the animal decreases it's metabolic rate, energy cons...
Q: What are the main respective components of cell walls in bacteria, protists, fungi and plants?
A: Cell wall It is a structural layer that surrounds some types of cells, situated outside the cell m...
Q: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a disorder that affects the normal function o...
A: Introduction: G6PD is an X-linked recessive disorder that results in defective glucose-6-phosphate d...
Q: 1. compare the dissected pig human models viewed in the lab book structure pig human number of l...
A: INTRODUCTION The comparision between different structures of pig and human is given below.
Step by step
Solved in 2 steps
- I am a gram-negative bacteria, only a chemoheterotroph, a pathogen and spiral shaped. What am I? Group of answer choices Spirochetes Proteobacteria Gram-positive bacteria CyanobacteriaMatch the following with the choices on the right Bacteria 1. Eukaryotic photosynthetic organisms that are not plants 2. Nucleic acid in a protein coat 3. An infectious particle that is a protein Archaea Fungi Protozoa Algae Platyhelminthes Nematoda Viruses Viroids 4. Prokaryotes, usually with peptidoglycan Prions cell wallsI am doing my microbiology homework and I need help with these questions: 1) List the structures ALL bacteria possess. 2) Identify three structures SOME but not all bacteria possess. 5) Describe the structure and function of three different structures found outside of the bacterial cytoplasmic membrane. 6) Differentiate between the two main types of bacterial envelope structures. 7) Why are Gram-positive cell walls stronger than Gram-negative cell walls? 8) Name a substance in the envelope of SOME bacteria that can cause severe symptoms in humans. 9) Describe the causes of sporogenesis and germination 10) Compare and contrast the major features of archaea, bacteria and eukaryotes by completing the table below. Characteristic Bacteria Archaea Eukarya Chromosome Type of Ribosomes Protein Synthesis Similar to Eukarya Sterols In Membrane Membrane-bound Organelles Peptidoglycan in Cell wall
- Which of the following diseases is NOT associated with bacteria that form endospores? tetanus anthrax toxic shock syndrome botulism gangreneThe microbiology department is celebrating the end of the school year in May by holding its traditional picnic on the green. The speeches drag on for a couple of hours, but finally all the faculty and students can dig into the food: chicken salad, tomatoes, onions, salad, and custard pie. By evening, the whole department, except for two vegetarian students who did not eat the chicken salad, is stricken with nausea, vomiting, retching, and abdominal cramping. Several individuals complain of diarrhea. One patient shows signs of shock (low blood pressure). Blood and stool samples are collected from patients, and an analysis of all foods served at the meal is conducted. Bacteria can cause gastroenteritis (inflammation of the stomach and intestinal tract) either by colonizing and replicating in the host, which is considered an infection, or by secreting toxins, which is considered intoxication. Signs and symptoms of infections are typically delayed, whereas intoxication manifests within…Hello, Please answer the following attached Microbiology question AND ANSWER ALL 3 PARTS COMPLETELY. Thank you. *If you actually solve all of the THREE PARTS (QUESTIONS) CORRECTLY AND COMPLETELY, I will 100% leave a thumbs up. Microbiology Question: "The attached picture is a gram stain for mycobacterium tuberculosis. What does the Gram Stain photo look like? Based on this attached picture, please explain whether it is Gram-positive or negative. Also, please explain the colors chemistry and shape. Thank you
- Mycoplasmas are pleomorphic bacteria. How do the unique structural characteristics of mycoplasmas relate to their bacterial morphology? Mycoplasmas have a low G + C genome content. Mycoplasmas appear Gram negative when a Gram stain is performed. Mycoplasmas lack a cell wall. Mycoplasmas form colonies with a fried-egg appearance.Which of the following is most susceptible to antimicrobial agents? mycobacteria bacterial endospores protozoan cysts vegetative bacteriaYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- The peptidoglycan layer of Gram-positive bacteria is exposed to the extracellular environment. True Falsewrite out a detailed summary on E.Coli. Questions below will help yu frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH) What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food? How many cases occur each year? In the US and/or worldwide and/or in the County where you live Has it caused any outbreaks or epidemics? Thank you-Please answer fast 1) This member of class Alphaproteobacteria has a unique method of moving around and orienting itself within its environment. This organism contains magnetosomes which allow it to respond to magnetic fields. Group of answer choices 1/ Flavobacterium johnsoniae 2/ Mycoplasma genitalium 3/ Thiomargarita namibienus 4/ Magnetospirillum magnetotacticum 2)This member of class Saccharomycota can use either aerobic respiration or fermentation to metabolize glucose. Group of answer choices 1/ Flavobacterium johnsoniae 2/ Magnetospirillum magnetotacticum 3/ Saccharomyces cerevisiae 4/ Staphyloccous aureus 3)This bacterium can live in viscous environments. It uses its flagella to move around and to stick to tissues. Group of answer choices 1/ Magnetospirillum magnetotacticum 2/ Helicobacter pylori 3/ Flavobacterium johnsoniae 4/ Mycoplasma genitalium 4)This member of Class Gammaproteobacteria lives in oxygen-poor environments and detoxifies…