Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characteristic is not true to all members of the group, then write NY Characteristics Fungus Bacteria Protozoa eukaryotic prokaryotic Cell wall Motile spores Binary fission unicellular
Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...
A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...
Q: Which of the following statements about the world population is NOT true?
A: Analysts estimate that the global carrying capacity of the earth is about 50 billion. The world popu...
Q: Describe the symport process by which cells lining the small intestine import glucose. What ion is r...
A: Active transport includes the use of metabolic energy for the transport of substances.
Q: Gather data about the Protista - protozoa (Entamoeba histolytica), an organism from the Protista kin...
A: Domain: Eukarya Kingdom: Protista Phylum: Sarcomastigophora Subphylum: Sarcodina Class: Lobosa Order...
Q: Which of the following is true of addiction? a) When the program asks a participant to move to a tre...
A: The correct answer is - All are true statements.
Q: What additive ingredients are thickeners? Total Fat Sat. Fat Cholesterol Sodium Total Carbohydrate D...
A: Out of the option given all are used as thickeners except caramel colour. Caramel colour is a sugar ...
Q: Describe the scope of human population growth
A: Population growth is the increased number of humans in the world. Most of the human history shows th...
Q: Which of the following have a four chambered heart? Choose all that apply. snakes & lizards crocodil...
A: Heart is divided into various chambers depending on the types of blood it contains like oxygenated b...
Q: In plants, the transition from water to land most likely happened once twice: ones in the moss linea...
A: The difficulties that the primary land plants needed to defeat going limp in land from gravity, the ...
Q: What is the benefit of alternative splicing? Tho nolarit of a protein can be adiusted for other circ...
A: Alternative splicing is the process of removal of introns and joining of exons in different combinat...
Q: What is transpiration
A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...
Q: e strongest force that caause plate movement is
A: Thermal convection is a force which is caused by the heat of the interior of the earth. Hot currents...
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. ...
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary ...
Q: action of beta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agents on bacterial ce...
A: Microorganisms are killed or slowed by antimicrobial agents. Bacteria, viruses, protozoans, and fung...
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans: TTACACTTGCTTGAGAGT...
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for you...
Q: Describe how an individual's genotype influences their chance of contracting malaria: Which individu...
A: Malaria is an infectious disorder due to the malarial parasite, Plasmodium falciparum. it's miles tr...
Q: The Human Family Tree” Video Questions 4. How did movement into other parts of the world influence o...
A: Genotype is the genetic constitution of a person this is ultimately responsible for the occurrence o...
Q: Discuss and explain deamination and repair
A: Repair of deamination product is done by base exision repair. Enzymes like DNA glycosylase, AP Indon...
Q: (mg) |(mg/fl oz) 55 4.6 38 1.9
A: The graph shows a plot of Heart Rates before and after intake of Caffeine in the diet of a concerned...
Q: The reactants and products of the light reactions. Explain how light supports the light reactions wi...
A: According to our guideline we can answer only the first three subparts of a question. So, please upl...
Q: Aside from outer pinna, what structures do mammals have in their ears that reptiles and birds do not...
A: * pinna is absent in many mammals and this organ acts as a heat dissipator but not involved in hea...
Q: Movement of glucose from one side to the other side of the intestinal epithelium is a major example ...
A: Digestion of carbohydrates produces monosaccharides.
Q: Describe how DNA moves from cell to cell by: a. conjugation b. transduction c. transformation
A: A bacterium takes a fragment of DNA drifting in its surroundings during transformation.A virus unint...
Q: Which of the following are jawless? Choose all that apply. O hagfish O lampreys O bony fishes O cart...
A: Jawless organisms are belongs usually to class Agnatha and primitive in nature.
Q: The lumbar region is ________.a. inferior to the gluteal regionb. inferior to the umbilical regionc....
A: Vertebrae of a human spine is divided into cervical, thoracic, lumbar, sacral and coccygeal. Out of ...
Q: Identify two body processes that occur by mitosis
A: Mitosis is a cell division that forms two daughter cells from a single parent cell.
Q: Which of the following statements concerning T cell development is correct? A. Progenitor T ...
A: * T cell are part of the immune system from which they develop from stem cells in the bone marrow. ...
Q: Now talk about how it affects newly synthesized proteins, SUMOylation impacts protein and protein in...
A: There are many post-translational modifications to proteins that alter cellular activity including s...
Q: Differentiate vasculogenesis from angiogenesis
A: Vasculogenesis- vasculogenesis is the de Novo synthesis of blood vessel. It leads to the development...
Q: Does the DNA content of the cell change from the beginning of interphase to the end of interphase? D...
A: Mitosis Mitosis is a process of cell division, where a single cell divides into two identical daught...
Q: Explain the four classification schemes of streptococci species
A: streptococci are gram positive bacteria, having spherical or oval coccus aligned in a chain form. Th...
Q: Meiosis_______ . a. occurs only in animals b. supports growth and tissue repair in multicelled spec...
A: Meiosis is a cell division that forms four progeny cells from a single parent cell.
Q: Describe the relationship between telomeres and senescence.
A: Chromosomes are the linear structures present during cell division.
Q: 5. Suppose that you made a mistake when you set up the thermocycler program and omitted the first 2 ...
A: Answer: 5 : the first 2 minutes at 95 degree Celsius is needed to open the dna if this is omitted th...
Q: 10. A student group decides to conduct an experiment testing the germination rate of radish seeds so...
A: Calculating results To calculate germination percent, divide the wide variety of healthful seedlings...
Q: ENDEMIC SPECIES IN THE PHILIPPINES Eggs with Shells No. Vertebrae Hair Wings Bilateral Symmetry 1 Ph...
A: Phylogenetic tree is a representation in which relationship of taxon with each as well as it's ances...
Q: Which of the following statements about E. coli is true? Some infections can be fatal to humans. It ...
A: Correct option A i.e some infection can be fatal to humans.
Q: 7. A researcher examining a root tip observes a plant cell with condensed sister chromatids, kinetoc...
A: Mitosis is the equational division where two genetically identical daughter cells are formed. In the...
Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...
A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...
Q: Photosynthesis in green and purple bacteria does not produce O2. Why? How can these organisms still ...
A: Photosynthesis is the process that occurs in the presence of sunlight.
Q: What is a selective sweep? O When a beneficial mutation is lost due to genetic drift. O When a benef...
A: Certain terms are fundamental concepts in biology, the study of living organisms. Theses terms are s...
Q: . What are the number of total chromosomes that carries the genes encoding heavy and light chain pol...
A: Introduction :- Immunoglobulins or antibody are made up of two light chains and two heavy chains of ...
Q: Which part of this inner ear labyrinth has otoliths that roll over gel-topped sensory cells to send ...
A: The ear is divided into three parts viz., inner ear , middle ear and outer ear. The inner ear is als...
Q: Describe alleles and why they occur on homologous chromosomesof sexual reproducers
A: The term "chromosome" is derived from the Greek word for "color (chroma) and body (soma)." Thread-li...
Q: Hello, can you pls explain the 5 different swimming styles and strokes. Thank you. • freestyle ...
A: Answer 5 different swimming styles and strokes 1.free style 2. Back stroke 3. Breast stroke 4. Butt...
Q: hat are the differences of hibiscus from other kingdom?
A: Hibiscus belongs to Kingdom Plantae. Differences of Kingdom plantae from other kingdoms are mentione...
Q: What effect do sodium, caffeine, and alcohol have on calcium levels in the body?
A: The human body is made up of everything that makes you, you. Our genetic information determines and ...
Q: Discuss how the study of microbial biofilms has evolved over time and the contribution of Bill Coste...
A: Biofilm is a term used for defining an association of microbial cells and layer of exopolysaccharide...
Q: which cellular function is performed by only some types of cells?
A: Acording to question unique cells play which type of cellular function answer is brifly written in 2...
Q: The cell pictured to the right is in whichstage of nuclear division?a. metaphase II c. anaphase IIb....
A: Mitosis is the phase of the cell cycle where the nucleus of a cell is divided into two nuclei with a...
Given the groupings of microorganisms, please indicate within the prescribe column whether these characteristics belongs to the group. Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characteristic is not true to all members of the group, then write NY
Step by step
Solved in 2 steps
- Mycorrhiza – What is mycorrhiza? Describe the differences between the two main categories endomycorrhiza and ectomycorrhiza. Select one (ecto or edo) and discuss its symbionts. Describe the processes involved in your topic. Find Reserach and Briefly describe the results of the paper (papers) you read on your topic. This should be a couple of paragraphs, at least. Be creative. List your sources (sources should also be cited in the text – see citation documentSalmonella typhi Cyanobacteria Name of Anabaena spiroides microorganism (Genus species) Morphology Colonies or single cells? Size estimation Cellular structures found in each Write a short compare and contrast paragraph between the microorganism you chose and Anabaena. This paragraph should be at least 3-4 sentences long and include at least two similarities and two differences for full credit.You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- Lysogenic Cycle Domain Anaerobic Cellulose Species Heterotroph Conjugation. Gram Positive Chitin 1. An organism that cannot make it's own food and must find food in it's environment. 2. What cell membranes of fungi cells are made of. 3. Viral reproduction where DNA is injected into the host and becomes a part of the host chromosome. 4. Indicates that peptidoglycan is present in the cell wall. 5. Does not require oxygen. 6. Sexual Reproduction in Bacteria. 7. Most general taxa. 8. Most specific taxa. 9. None of the above Please match the followingean.khpcontent.com/biology/page/ch23pretest?type question-list&page_type-6896389 D YouTube * Maps raprer 1 Ablgall CAMERON- October 03, 2021 12:45:43 PM Return to Site 4. 56 1 3 9 10 11 12 13 14 15 16 17 (15 of 17) Match each group in the left column with the corresponding grouping in the right column. Marchantiophyta А. Non-vascular plants Lycopodiophyta В. Seedless vascular plants С. Pterdiophyta Non-vascular plants D. Seedless vascular plants Bryophyta E. Non-vascular plants Anthocerophyta Note: Clicking any button other than the Save Answer button will NOT save any changes to your answers! Save Answer Skip Question I Am Finished/Submit for GradeQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- characterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium D (see image) Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium D. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. 3. 4. 5. 6. Presence and shape of a heterocyst in the trichome Presence and shape of akinetes in the trichome Presence of baecytes (endospores) in a colony Polarity and tapering of the trichome Shape of end cells in a filament Presence of a gelatinous or colonial sheath Presence of branching Protoplasm color Protoplasm granulation Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) 7. 8. 9. 10. 11. 12. 13. 14. Vegetative cellular arrangement (grouping) Number of cells in large aggregates (colonies) Layers of trichomes in a filament Latest Classification based on Algaebase (algaebase.org) Kingdom:…Help indetifying the unknown bacteria ? Gram Stain: Purple Cell Morpholgy: Rods Oxygen Requirement: OA Acid Fast Stain: pink Endospore Stain: pink rods Blood agar-hemolysis: no lysis Phenol red-glucose fermentation:red,no gas Phenol red -lactose fermentation:red,no gas Phenol red - mannitol fermentation:red,no gas Phenol red-sucrose fermentation: red,no gas Methyl red:no change Voges-Proskaur: no change Oxidase: no change Catalase: bubbles Nitrate Reduction: red after a & bHelp indetifying the unknown bacteria ? Gram Stain: Pink Cell Morpholgy: Bacillus Oxygen Requirement: OA Acid Fast Stain: green Endospore Stain: pink rods Blood agar-hemolysis: lysis (yellow clearing) Phenol red-glucose fermentation:red,no gas Phenol red -lactose fermentation:red,no gas Phenol red - mannitol fermentation:red,no gas Phenol red-sucrose fermentation: red,no gas Methyl red:no change Voges-Proskaur: no change Oxidase: purple Catalase: bubbles Nitrate Reduction: red after zinx
- Matching type. Match the items in column A with that in column B. Column B A. Physarum B. Aspergillus Column A 1.conidiospores 2. apothecia 3. plasmodium 4. basidiospores 5. quill wort C. Lycoperdon D. Dictyostelium E. Polypodium 6. sunflower F. Caryophillids 7. coconut palm G. Allomyces 8. magnoliids H. Pelomyxa I. Liliales 9. spike moss 10. prothallus J. Rhizopus 11. maiden hair tree K. Isoetes 12. isidia/soredia L. Pezizza 13. orchids M. Ranunculales 14. arbuscular mycorhizae N. Rosids 15. amitochondriate O. Persea americana (avocado tree) P. Commelinids Q. Ginkgo R. Selaginella S. Asterids T. Glomeromycota U. lichenCharacterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium A (see image) Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium A. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. Vegetative cellular arrangement (grouping) 3. Number of cells in large aggregates (colonies) 4.Layers of trichomes in a filament 5.Presence and shape of a heterocyst in the trichome 6. Presence and shape of akinetes in the trichome 7.Presence of baecytes (endospores) in a colony 6.Polarity and tapering of the trichome 9.Shape of end cells in a filament 10.Presence of a gelatinous or colonial sheath 11. Presence of branching 12.Protoplasm color 13. Protoplasm granulation 14.Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) Latest Classification based on Algaebase (algaebase.org) Kingdom: Phylum/Division:…MICROBE PROFILING Instructions: Choose any microorganism from the different groups of cellular and acellular and fill in the information required for your chosen microbe for profiling. 1. Scientific Name and common name of the microbe: 2. Importance: 3. Cellular or Acellular? 4. If cellular, eukaryote or Prokaryote? 5. If cellular, which Kingdom? 6. General Morphology (describe cell types, parts of cells, size, etc.): 7. Where are they commonly found? 8. Source of nutrition: 10. Does it cause human infection? (Yes or No); What disease? 11. If they cause diseases, how can we prevent the infection? 12. Representative photo 13. References: