In this exercise, you will compare the amino acid sequence from the aphid to the amino acid sequences of the other species to identify how similar they are. As a first step, you wll compare the aphid sequence (Acyrthosiphon) to a bacterial sequence (Pantoea). The sequences below show the first 60 amino acids of one polypeptide, using the one-letter abbreviations for the amino acids. An underscore ) indicates a gap inserted in a seque to optimize its alignment with the corresponding sequence in Arabidopsis. Acyrthosiphon (aphid) IKIIIIGSGV GGTAAAARLS KKGFQVEVYE KNSYNGGRCS IIR_HNGHRF DOGPSL_YL Pantoea KRTFVIGAGF GGLALAIRLQ AAGIATTVLE QHDKPGGRAY VWQ DQGFTF DAGPTV (bacterium) IT At how many positions are the amino acids the same between the two species? positions with the same amino acid. There are Submit Request Answer

In this exercise, you will compare the amino acid sequence from the aphid to the amino acid sequences of the other species to identify how similar they are. As a first step, you wll compare the aphid sequence (Acyrthosiphon) to a bacterial sequence (Pantoea). The sequences below show the first 60 amino acids of one polypeptide, using the one-letter abbreviations for the amino acids. An underscore ) indicates a gap inserted in a seque to optimize its alignment with the corresponding sequence in Arabidopsis. Acyrthosiphon (aphid) IKIIIIGSGV GGTAAAARLS KKGFQVEVYE KNSYNGGRCS IIR_HNGHRF DOGPSL_YL Pantoea KRTFVIGAGF GGLALAIRLQ AAGIATTVLE QHDKPGGRAY VWQ DQGFTF DAGPTV (bacterium) IT At how many positions are the amino acids the same between the two species? positions with the same amino acid. There are Submit Request Answer

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein sequences Q4VW83 and Q4VW8
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtga
Using the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) B
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
We have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tablo
Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
Representations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Val
In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is shown below. There is a stack at eachposition, even if short, because the sequence logo includes moredata. (a) Which three positions in this sequence logo have the mostpredictable bases? Name the most frequent base at each. (b) Whichfour positions have the least predictable bases? How can you tell?