In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is carbon 6. is the anomeric
Q: Which of the following correctly illustrates a dipeptide and an amino acid in the optimal position…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 10) Determine bending rigidity of double stranded DNA molecule with persistence length of 45 nm (80%…
A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…
Q: f What advantage is there to phosphoglycerate kinase having an open and closed protein…
A: Glycolysis is the 10-step enzymatic conversion of 1 molecule of six-carbon glucose to two molecules…
Q: Orotic aciduria is treated with: ○ Tetrahydrofolate O 5-flourouricil O Uridine supplements O Calcium…
A: Patients suffering from Orotic aciduria have increased levels of orotic acid in their urine.…
Q: true/false: The carbon skeleton produced by catabolism of asparagine enters glycolysis as…
A: Anaplerotic reactions are reactions that produce intermediates of TCA cycles. Conversion of…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…
Q: Starch is a polysaccharide 1.Is starch positive in Bial‘s test?(what color ?) 2.Is starch positive…
A: Introduction: Polysaccharides are polymers of D-glucose that are joined together by glycosidic…
Q: Upon doing the experiment in Protein Denaturation, what could happen in the precipitation of heat…
A: Protein solubility is determined by the proportion & distribution of polar hydrophilic and…
Q: Which statement is CORRECT? A) Glucokinase is not inhibited by glucose-6-phosphate B) Pyruvate…
A: INTRODUCTION : Glycolysis - It is a metabolic pathway in which glucose is metabolised / broken down…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Please explain this table (just the endothelial cell density)
A: Endothelial cells are a single layer of cells that lines all the blood vessels, lymph cells,…
Q: Questions: 1. What test tube will show positive starch hydrolysis and negative starch hydrolysis?…
A: Starch is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: What is the overall net reaction of glycolysis? C6H12O6 + 2 NADH + 2 P₁ + 2 ATP --> 2 C3H3O3 + 2…
A: In glycolysis, glucose is oxidized into pyruvate. It involves a series of enzyme-catalyzed…
Q: 4. Peculiarities of hormonal regulation of glycogen metabolism in muscles and liver.
A: The glycogen synthesis mainly occurs in the muscle, and liver, using glucose-6-phosphate. The…
Q: Tumor necrosis factor (TNF) signaling Discuss the nature of the TNF ligand and the receptor for…
A: Cell signaling pathway involves a cascade of reactions inside the cell which is triggered by small…
Q: The carbon skeletons of many amino acids can be used to replenish the intermediates of the citric…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: Describe two reasons why the reaction glutamine synthetase performs is important to the body.
A: Cells can accumulate nitrogen in the form of ammonia from amino acid degradation, photorespiration…
Q: High levels of glucose-6-phosphate inhibit glycolysis. If the concentration of glucose-6-phosphate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: The expresion ytou have like [deprotonate][protonate]. Are they multiplying or dividing? Is not…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: true/ false: When proteins are denatured 1°, 2°, 3°, and 4° structure is lost.
A: Denaturation is a process in which proteins lose their original structure or confirmation. The loss…
Q: Increased citric acid levels in the blood will stimulate which of the enzymes listed below? Select…
A: Citric acid is a weak organic acid produced in citric acid cycle, i.e. acetyl co A reacts with…
Q: Based on what is known about the mechanism of Chymotrypsin, which molecules would be inhibitors of…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: What is the role of HCO3 in the activity of pancreatic enzymes? 2. What factors are needed in the…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: In the Krebs cycle, the energy released by taking a compound off Coenzyme A is used to: Group of…
A: There are 2 two reactions in Krebs cycle were a compound is taken off Coenzyme A (CoA-SH). These two…
Q: Suppose that you have decided to test whether the tyrosine residue of the spike protein is important…
A: Amino acids are the building blocks of protein. They are classified into different groups like…
Q: Name four amino acids that can be synthesized using pyruvate as a starting material. What one(s) of…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 7. WHAT IS A PHOSPHODIESTER BOND? WHERE CAN IT BE FOUND? 8. GIVE AT LEAST 10 CARBOXYLIC ACIDS THAT…
A: Biomolecules are composed of monomeric units that are joined together through specific bonds.…
Q: Consider the following pairs of fatty acids and underline the fatty acid in each pair that will have…
A: Fatty acids are very important class of macromolecules in our body. They are the simplest type of…
Q: You are running a size exclusion column to purify your 25 kDa protein from a lysate mixture. The…
A: Size exclusion column chromatography: As a function of their respective sizes, molecules are…
Q: Experiment: Lipids Qualitative Tests Test Performed: Translucent Test Procedure 1. Fold your…
A: Lipids are a chemically diverse group of biomolecules with two common characteristics: low…
Q: Which of the following statements is correct regarding the structures below? CHO CHO но-н H H-OH ОН…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: 60. During a study of thyroid hormone function, an experimental line of mice is genetically…
A: the thyroid gland malfunctions and doesn't produce enough thyroid hormones: thyroxine and…
Q: * 15-14 AG AG is +6.64 kJ/mole +1.59 kcal/mole for the reaction Citrate - = Isocitrate. is -267…
A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…
Q: Imagine that you were asked to denature a protein; you know you can do so using urea. Your protein…
A: Denaturation is the process by which a protein looses it native structure, to the level that protein…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: In the last stage of cellular respiration (ETS and oxidative phosphorylation) what is the fate of…
A: ETS (Electron Transport System) is a sequential arrangement of proteins (Protein complexes I, II,…
Q: Choose the best answers for each missing word from the list below. (1)__________ is a first…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: NH4+ is transported indirectly in the body. Why can’t free NH4+ be transported in the blood? How is…
A: NH4+ is the waste product formed from the amino acids on their catabolism. It must be transported…
Q: The enzyme thiolase catalyzes one step in the ß-oxidation of saturated fats. One portion of the…
A: Fatty acids are transported into the cell. The enzyme fatty acyl-CoA synthase(FACS) adds a CoA group…
Q: Ketohexoses commonly exist in living systems in either the straight chain or ring (furanose) forms.…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: What are some applications for metalloproteins?
A: Metalloproteins are the types of proteins or enzymes that binds to a metal ion as a cofactor in…
Q: 18:249, 12 refers to a fatty acid that contains: 18 carbons, 2 double bonds, and saturation at…
A: Fatty acids are the simplest type of lipids. They are carboxylic acids with hydrocarbon chain. They…
Q: Why is cholesterol an important steroid?
A: Steroids are the compounds that consist of three cyclohexane rings and a cyclo pentane ring in…
Q: Why do enzymes contain metals? What general reaction types to metalloenzymes catalyze?
A: Enzymes are biological catalysts proteinateous in nature that catalyze large number of biochemical…
Q: Energy extraction and the complete oxidation of foodstuffs requires three stages. The energy…
A: Introduction Glycolysis is a process by which glucose molecules are converted into pyruvate and…
Q: Prepare 1.5L 2X Base stock in a media bottle: Fill out the last column of this table: Component…
A: A buffer is a solution that can resist pH change upon the addition of acids or bases. Buffers…
Q: Identify the reasons why the DNA molecule you selected would lead to DNA synthesis. It is…
A: An important characteristic of DNA replication is that it is semiconservative. Two strands of DNA…
Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: DNA is the genetic material in most organisms. During transcription RNA Polymerase synthesizes the…
Q: Which major biosynthetic pathways utilize PRPP? de novo purine synthesis lysine biosynthesis…
A: INTRODUCTION: De novo purine synthesis- it is the synthesis of complex molecules from simple…
Q2
Step by step
Solved in 2 steps with 1 images
- In the following monosaccharide hemiacetal, identify the anomeric carbon atom. Identify the appropriate atom by selecting an atom and assigning it a map number of 1. To do this, rigl mark to enable the Map field before entering a value. H: 122 EXP" CONT. 0 0 H но OH S Br OH [1] ÓH P. -Stereochemistry in biological molecules is often denoted by the D- and L- convention, instead of the R- and S- configurations determined by the Cahn-Ingold-Prelog methodology. Naturally occurring α-amino acids are typically in the L-configuration. The Fischer projection of L-alanine is shown. L-alanine H₂N- H3C- HOOC Identify which structures are equivalent to the L-configuration. H COOH H CH3 NH₂ -COOH NH₂ CH3 -H CH3 COOH H -NH₂ H₂N- H CH3 COOH NH₂ H CH3 -COOHOOC H₂C 1 H₂C H₂C H₂C-C HC H₂C NH N CON HN C COO™® 1 CH₂ CH₂ C-CH₂ CH C-CH, G=CH₂ "ooc H₂C H₂C H₂C H₂C-C HC 0-N H₂C Fe(ll) COO 1 CH₂ CH₂ C-CH₂ C-CH₂ G=CH₂ The structure below is Fe- protoporphyrin IX. It is linked by bridging groups to form porphyrin ring. Addition of Fe to the porphyrin rings produces the heme group. Identify the group of atoms that can for H-bond interaction with water.
- DHA is a fatty acid derived from fish oil and an abundant fatty acid invertebrate brains. Hydrogenation of DHA forms docosanoic acid[CH3(CH2)20CO2H], and ozonolysis forms CH3CH2CHO, CH2(CHO)2 (fiveequivalents), and HCOCH2CH2CO2H. What is the structure of DHA if all double bonds have the Z configuration?Use Frost Circles to complete the molecular orbital diagram for cyclooctatetrane. Label the bonding, non bonding, and anti bonding MO’s. If the molecule is planar, would it be aromatic, antiaromatic, or nonaromatic? If the molecule is nonplanar, would it be aromatic, antiaromatic, or nonaromatic?Following is a structural formula for the amino acid cysteine: 11 HS-CH₂-CH-C-OH NH₂ Name the three functional groups in cysteine. a. What is the name of the highlighted functional group? HS-CH₂-CH-C-OH NH₂ O carboxyl group O amino group O thiol group O disulfide group What is the name of the highlighted functional group? O HS-CH₂-CH-C-OH NH₂ O carboxyl group O amino group O thiol group O disulfide group Previous Next
- Match the structures below with the type or name of the structure. Each match should be used only once. > CH₂ CH- но. CH HO CH₂ CH-0_8 0= CHÍNH CH,O L CH₂0-8- CH2O O=C O–CH,CH O=0 NH3 2−CH2-CH NH3 COO 1. triacylglyceride 2. fatty acid 3. phosphatidyl serine 4. sphingomyelinStereochemistry in biological molecules is often denoted by the D- and L- convention, instead of the R- and S- configurations determined by the Cahn-Ingold-Prelog methodology. Naturally occurring a-amino acids are typically in the L-configuration. The Fischer projection of L-alanine is shown. L-alanine H₂N- COOH H- CH3 Identify which structures are equivalent to the L-configuration. CH3 H -NH₂ COOH H COOH NH₂ -CH3How many peptide bonds were produced by creating the following How many H2O particle were produced by creating the following structure if the starting reagent is glucose? * structure if the starting reagent is glucose? * CH,OH CH,OH CH,OH CH;OH CH;OH CH;OH OH он он OH 250 ÓH OH OH ÓH OH OH 300 А.) 125 B.) 250 А.) 30 c.) 25 B.) 301 D.) 500 C.) 302 E.) O D.) 300 E.) 150 F.) O
- Choose the correct structure for thiamine hydrochloride at pH 3. H3C H3C NH₂ NH₂ 'N CI- A CI- с CH3 CH3 S HCI OH N NH3 H3C N H3C CI- B NH₂ CH3 ** N CH3 D HCI -OH OHDraw the bond-line dash-wedge structure and the Fischer projection of the following For each compound, draw the Newman Projection down the C2-C3 bond in the lowest energy conformation.Consider the structure shown below. он 3 5 CH; O CH, O H CH; O 1 H-N-CH,-C-N-CH;-C-N-CH-C-N-CH-C-N-CH-C-ơ 2 H. H H Fill in the blank with an integer (1, 2, 3, 4, 5..) as shown in the diagram or to represent a specified number. A hydrophilic side chain is indicated by the number