In the above diagram, which letter represents a K+ ion?ABOE In the above diagram, letter C represents:A voltage-gated K+ channelA leaky Na+ channelA leaky K+ channelA voltage-gated Na+ channel

Introduction = definition of ion channels: A protein that acts as a pore in a cell membrane and…

Answered: In the above diagram, letter C…

In the above diagram, letter C represents: O A voltage-gated K+ channel O A leaky Na+ channel O A leaky K+ channel O A voltage-gated Na+ channel

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter4: Principles Of Neural And Hormonal Communication

Section4.3: Action Potentials

Problem 2CYU

See similar textbooks

Related questions

Q: (iii) (iv) What are the three (3) main cycles in PCR? Discuss the processes at each PCR cycle…

A: Polymerase Chain Reaction ( PCR) is a technique used to make millions or billions of copies of the…

Q: The majority of colon cancers begin with an alteration of which gene below (select one)? A.…

A: During the time of cell division , cell basically undergo splitting process at regular normal…

Q: Agricultural runoff is a major source of pesticide and excess nutrient pollution. This is a…

A: 1) As agricultural runoff moves, gathers up, and carries away both natural and man-made pollutants,…

Q: Many invasion process models (including the framework in Blackburn et al. 2011) have emphasized that…

A: Invasion : Biological invasion is a process by which an organism introduced to and establishes a…

Q: 1. Consider a cell with surface area 2.5 x 102 mm², initial water potential of -0.3MPa and membrane…

A: When the temperature and the pressure are held constant then the potential energy of the water to…

Q: To be considered invasive, a species would likely have population growth rates (r) in the introduced…

A: Population growth rate : Population growth rate is the rate of change in the population, in a given…

Q: 7. Match the bases: Adenine, thymine, cytosine and guanine as found in DNA. 8. Which sugar is found…

A: Biomolecules are the most important organic compounds that are engaged in the upkeep and metabolic…

Q: List the classification of fatty acids based on their chemical structures, as well as their…

A: Introduction :- The building blocks of fat in our bodies and the food we eat are called fatty acids.…

Q: Use the following information to answer the next question. The Life Cycle of a Fern 1 and 3 2 and 4…

A: *A fern is a vascular plants which reproduce through spores and it doesnt have seeds and flowers.…

Q: Does the prenatal environment have an influence on a fetus's future developmen

A: Introduction Mammals include people. This was a lesson we all had in elementary school.…

Q: Describe four different uses for thoracic appendages seen in different crustaceans. Use specific…

A: Crustaceans form a large, diverse arthropod taxon which includes animals such as decapods, seed…

Q: How are lipids related or important to Grease-Spot test, Solubility Test, and Emulsification?…

A: Introduction The human body's ability to maintain homeostasis depends on fats and lipids. One or…

Q: Chlamydia are pathogenic bacteria that must be grown within a eukaryotic host cell. They rely on the…

A: Introduction:- Chlamyadiaceae are obligate intracellular bacterial pathogens that strictly depend on…

Q: 2. If a potted plant is covered with a glass jar, water vapors appear on the wall of glass jar.…

A: Transpiration is the process through which water is evaporated from plant components with stomata,…

Q: the function of the cell membrane and pathogenicity of covid.

A: What are the Function of the cell membrane and pathogenicity of SARS-Cov2

Q: Light is needed for photosynthesis, because it

A: Plants and other living things perform a process called photosynthesis to transform light energy…

Q: What is the name of the DNA strand which copies the MRNA?

A: The DNA is genetic material in living organisms that is made up of two antiparallel polynucleotide…

Q: 1. Why do meristematic cells have a prominent nucleus and dense cytoplasm but they lack vacuole?

A: Plant cells with the capacity to proliferate and give rise to new cells are known as meristematic…

Q: Describe the steps of DNA replication.

A: Introduction: DNA replication means replicating or producing two same replicas of DNA from one…

Q: Here is the sequence of one strand of a DNA molecule: GTC/ATG/CCC/AGA/CTA What is the DNA sequence…

A: DNA stands for deoxy ribonucleic acid and which is present in the nucleus that acts as a genetic…

Q: Kary Mullis invented the Polymerase Chain Reaction (PCR) technique in 1983 which won him the 1993…

A: Polymerase Chain Reaction: A very small DNA sample can be amplified (or part of it amplified) to a…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: Speculate why humans have evolved additional barriers to tumors compared to mice. What are some of…

A: For almost all animals, old age is associated with a common decline in tissue structure &…

Q: In experiments in which rat embryo fibroblasts are transfected with suspected oncogenes,…

A: Myc gene basically a proto-oncogene that play a key role in cell cycle progression, cellular…

Q: homology modelling and such are available free online. State the functions of CLUSTAL W, BLAST and…

A: Numerous computational methods are used in bioinformatics, that include sequence and structural…

Q: Plant part Moncot or Dicot Reasoning

A: The term monocot is frequently used to describe flowering plants with seeds that typically only have…

Q: ATP hydrolysis is exergonic or endergonic

A: Please follow step 2 for detailed explanation.

Q: cule is subjected to complete striction digestion by (1) OKI alone, (2) HindIII alone, and (3) both…

A: Restriction enzymes are a special class of enzyme that cleaves the DNA molecule in particular sites.…

Q: 5. Differentiate between sclerenchyma and parenchyma tissues.

A: Tissue is a group is cells having similar structure, shape and functions together.

Q: Which numbers in the diagram represent where aerobic cellular respiration occur? 3 and 5 O2 and 3 2…

A: Respiration is basically metabolic process in which glucose is degraded and ATP is liberated. It is…

Q: Besides using A. tumefaciencs in the generation of transgenic plants, elaborate on the THREE (3)…

A: Agrobacterium tumefaciens, a gram negative bacteria that is used to perform horizontal gene transfer…

Q: It is often stated that excess mortality (in general) is higher in low socioeconomic populations.…

A: Mortality rate It is a measurement of the number of deaths (or deaths related to a particular cause)…

Q: Use the following information to answer the next question. Life Cycle of a Pronghorn Antelope…

A: The pronghorn contains deer like body whose tan is reddish brown. *Reproduction is the process of…

Q: Question 9 Smooth muscle is responsible for vasoconstriction. True False

A: Cells are the basic structural and functional unit of all known organisms which help in the process…

Q: Northern blot is an analytical technique commonly performed to study gene expression in experimental…

A: A tissue is defined as a group of cells that possess a similar structure and perform a specific…

Q: Which of the following statements concerning the location of the metabolic pathways is correct?…

A: Glycolysis is a series of reactions that produces energy from glucose by splitting Glucose molecules…

Q: 6. B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…

A: Introduction :- The lymphocyte class known as B cells is in charge of the humoral immunity portion…

Q: pZERO®-1 is a 2808 bp cloning vector from Invitrogen. This vector allows effective selection of…

A: The PET sequences are simentensously traced to the genome assembly to define the boundaries of…

Q: rest

Q: Autodock, Gold and Glide are other bioinformatics tools that are widely utilized by many researchers…

A: A technique called molecular docking examines how molecules are oriented and conformed within a…

Q: Differentiate between the following terms used in medical epidemiology: 4.1. Sporadic vs endemic…

A: Sporadic refers to a disease that occurs infrequently and irregularly, it does not show any common…

Q: What would be the fastest possible HR if the absolute refractory period for the cardiac myocytes was…

A: Introduction: Heart rate(HR) is a speed in which heart beats in every minute. It along with stroke…

Q: The following picture shows the ethidium bromide-stained bands obtained by gel electrophoresis of…

A: Electrophoresis is a molecular technique that employs the electrical field to assort biomolecules,…

Q: In gene cloning, a vector is required to transform the gene of interest into host cell. State the…

A: In gene cloning, a vector is required to transform the gene of interest into the host cell. The…

Q: is energy is released when ATP loses a phosphate group true about ATP and ADP

A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…

Q: A mature oak and hickory forest ecosystem experienced an intense forest fire that burned the…

A: A wildfire, also known as a forest fire, bushfire, wildland fire, wildland fire, or rural fire, is…

Q: Indicate what component (A to E) in the drawing corresponds to each of the following: Enhancers,…

A: By means of a process called DNA transcription, RNA polymerase rewrites the genetic data present in…

Q: What makes transparent softening lotion different from suspension softening lotion? Is it because of…

A: Cosmetics can be differentiated into various sub-categories based on various features, such as:…

Q: Consider the maternal effect gene that controls snail coiling where D= dextral, dominant,…

Q: Calculate the number of grams needed to prepare 100 mL of a 0.20 M solution of cobalt sulfate…

A: 1 mole of a substance is equal to that substance's Molecular weight The molecular weight is cobalt…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

In the above diagram, which letter represents a K+ ion?
A
B
OE

In the above diagram, letter C represents:
A voltage-gated K+ channel
A leaky Na+ channel
A leaky K+ channel
A voltage-gated Na+ channel

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The accelerating flow of _______ ions through gated channels across the membrane triggers an action potential. a. potassium b. sodium c. hydrogen d. a and b
Fill in the diagram, your illustration should demonstrate for each phase of the AP: 1. The relative concentration of K and Na 2. The relative voltage across the membrane 3. Any movement across the membrane of K and NA 4. The three kinds of channels in the membrane, and their state (open or closed) 5. Finally, indicate on the graph of the AP which phases correspond to hyper- polarization and which phases correspond to de- polarization Outside Outside Inside Inside Outside Inside Outside 1 Outside Inside Inside
Describe the action potential in terms of the different functional states of the voltage- gated Na+ membrane channels (Note: there are three states)
At point A, what state are the voltage-gated sodium channels and potassium channels in?
B A C Match the action potential phase in the plot below with the correct image below showing the Na+/K+ ATPase and voltage-gated K+ and Na+ channels. +50- D -50- -70- 0 E A B M D + OUT -IN [Choose ] [Choose] [Choose] SHE - OUT IN + OUT IN
A membrane potential (Vm) labeled axis on the graph In the graph draw the phases of the action potential Include the channels involved and when they open and close matching them to the Vm Indicate the periods in which the action potential can or cannot occur
The traces below show the action potential waveforms in an external meidum of different concentrations of * 40 100% 50% 33% 40 1 2 time (msec) calcium chloride potassium O sodium
The membrane potential for an excitable cell membrane is -70 mV, for sodium ions the Nernst equilibrium potential is +50 mV, the conductivity of the single sodium channel is 10 pS. What is the electrochemical potential difference that is the driving force for sodium ions to migrate? How much current flows through an open sodium channel under these conditions?
Draw the current that you would expect to flow during a voltage clamp experiment on a typical neuron. Voltages and time course are shown. Briefly explain why the currents are inward or outward. Be sure to provide scale bars. You should definitely label the Y axis so that the peak current value is obvious. Draw the Na+ current you would expect if there were physiological ionic gradients. Draw the K+ current you would expect if there are physiological ionic gradients. Draw the K+ current you would expect if the bath solution and the intracellular solution are both 125 mM.
Which of the following statements about voltage gated channels is true? Voltage-gated sodium channels open at a higher (more positive) membrane potential than do potassium-gated channels Voltage-gated sodium channels open at a lower (more negative) membrane potential than do potassium-gated channels Sodium- and postassium-gated channels open at about the same membrane potential, but they have different effects because there are different numbers of the two kinds of channels in neuron cell membranes
Which of the following is not an excitatory ligand-gated ion channel? NACHR AMPAR ASIC GABA-AR
Membrane Potential (mV) +35 0 -50 -70 0 A B C | 2 Time (milliseconds) 3 E 4 Use the figure showing phases of the action potential to answer the following question. Most of the voltage-gated sodium channels become open at label ____, and become inactivated at label