In DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?
Q: Which of the following is associated with pain relief? a. acetylcholine c. serotonin b. glutamate d....
A: Introduction: The term pain is an unpleasant sensory and emotional experience associated with actual...
Q: Three proteins K, L and M have the same % composition. Which is TRUE? A. The three proteins will ha...
A: Proteins are composed of a linear chain of amino acid sequences attached together via peptide bonds....
Q: which functional group remains charged at pH of 9. „NH2 H2N COOH
A: The pKa of the ionizable groups on an amino acid determines the net charge of the amino acid. Since ...
Q: Hormone Concentration (nM) Protein 1 Protein 2 Protein 3 0.2 0.048 0.29 0.17 0.5 0.11 0.5 0.33 1 0.2...
A: Hormone binding to receptor molecules can be determined by its affinity of binding. Hormone with hig...
Q: Read the paragraph below and answer the question: What makes the information on blood type interesti...
A: Blood typing is the Differentiation of blood groups based on the presence of type of antigens on sur...
Q: Glucose in stored in the body as glycogen. Consider the oxidation reaction for glucose with oxygen (...
A: Glycogen is a glucose polymer present in mammalian and nonmammalian cells, microorganisms, and plant...
Q: How does adjusting Mg2+ concentration affect the PCR yield and specificity? How does adjusting prim...
A: Introduction: Polymerase chain reaction involves the ampliifcation of a particular piece of DNA to p...
Q: Which has better emulsifying properties, soap or detergent. Explain your answer using the concept of...
A: Emulsifiers are those substances that decrease the surface tension between two phases which are comp...
Q: Select the two most hydrophobic amino acids. A. Leucine and Isoleucine OB. Arginine and Lysine OC Cy...
A:
Q: A biochemist discovers and purifies a new enzyme, generating the purification table shown. From the ...
A: The enzyme is a critical component of biochemical reactions that catalyzes and multiplies the rate o...
Q: What reaction is catalyzed by this enzyme (structures of molecules not needed)? Explain why this enz...
A: Triosephosphate isomerase catalyzes the isomerization or racemization reaction in 5th step of glycol...
Q: What is meant by the statement “The genetic code is universal”? What is the significance of this fin...
A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can pr...
Q: Four amino âĉid samples were subjected to a reverse-phase chromatography set up and yielded the foll...
A: Retention factors (Rf) values are important since they determine the differential separation of the ...
Q: OH NH+ он он + NADPH + H • NADP O hydrolase oxidoreductase O transferase O lyase isomerase ligasc
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases...
Q: Look at the amino acid composition of a protein given in the table and click on the area in the 2D g...
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid...
Q: 2. The following plots show an oxygen binding curve for hemoglobin under a certain set of conditions...
A: The shown in question is Oxygen-Hemoglobin (O2-Hb) dissociation curve where Y axis represent O2-Hb s...
Q: Which statement below best describes the main difference between how scientists define data and hypo...
A: Scientific Hypothesis is a part of scientific method which consists of 6 different steps. Scientific...
Q: Give a clear handwritten answer of this in which who have long chain of atoms in which molecules con...
A: Introduction: Macromolecules are larger molecules made from smaller ones. These macromolecules are c...
Q: CH3 CH2-CH,-CH2 CH2-CH,CH2-CH2-CH2 CH2-CH2 ĉ-SCOA
A: Beta oxidation is the process by which long chain acyl CoA are broken down to acetyl CoA. Each round...
Q: In cation exchange chromatography, positively charged proteins exit the column first. In anion excha...
A: Chromatography is a technique in which components of a mixture are separated. It consist of a mobile...
Q: Explain the features of commercially prepared plasmids ?
A: Plasmid play a critical role , specially in the area of genetic engineering , such as gene cloning ,...
Q: The order of elution of amino acids X, Y, VW and Z in a cation exchanger eluted with a buffer of inc...
A: Ion exchange chromatography is used to separate molecules based on the charge. In the ion exchange c...
Q: 3. The rates of a carbonic anhydrase catalyzed reaction of CO2 and H20, in the absence and presence ...
A: Carbonic anhydrases catalyze the interconversion between CO2 and H2O, maintain acid base homeostasis...
Q: rom bottom of vpside-down Inner tube to the top of the layer of bubbles glucose fructose sucrose wat...
A: During this experiment, the parameters that factor in the efficiency of alcoholic fermentation are a...
Q: These types of proteins come from foods that contain all amino acids for nitrogen balance and tissue...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: In general, proteins can be classified into 3 different groups. Name and give a short description of...
A: Proteins are considered as large biomolecules and also a macromolecules which comprise one or more l...
Q: Which of the following enzymes ensures that the correct base of a deoxynucleotide for growing the ch...
A: DNA replication is the process of duplicating a DNA molecule. Every time a cell divides, it must fir...
Q: Residue Asn 204 in the glucose binding site of hexokinase IV was mutated, in two separate experiment...
A: Hexokinase is the enzyme that catalyses the Phosphorylation of glucose to Glucose 6 phosphate in Gly...
Q: 8. Explain how to prepare 3 ml of a solution with a concentration of 2ug/5ml from a stock solution o...
A: For the preparation of this solution from a concentrated stock solution the formula V1 x S1 = V2 x ...
Q: Draw a peptide from the given amino acids Phe-Cys-Ala-Arg-Ala-Ser-Tyr. Try to cleave this oligopepti...
A: Pepsin exhibits a broad cleavage specificity but has a tendency to cleave the polypeptide chain in t...
Q: но- OH он о Но- OH HO HO- OF OH ÓH HO
A: The above given structure represents Stachyose. It is a tetrasaccharide made up of four molecules. T...
Q: Which of the following is TRUE about the enzymatic catalysis of a chemical reaction? A. It increase...
A: Enzymes are the biological catalysts that increase the rate of reaction by lowering the activation e...
Q: Which of the following disaccharides produces two different monosaccharides upon hydrolysis? maltos...
A: Disaccharides are the Carbohydrate molecules made up of two monosacharide units. The monosacharides ...
Q: Write the overall net reaction for photosyynthetic Co2 fixation. (Take into account both light and c...
A: Introduction: Photosynthesis is a process in which plants and bacteria use the energy from sunlight ...
Q: Provide a brief explanation as to why ligand binding to proteins must be a reversible process.
A: Since you have asked multiple questions, we will solve the first question for you. If you want any s...
Q: 4.1. From this structure, what is the predominant secondary structure of the protein? 4.2. Based on ...
A: As you have asked multiple sub part questions, we are supposed to answer only first 3 subparts . To ...
Q: Why are carbohydrates the body's preferred source of energy? Because they ... * A. are expensive t...
A: Carbohydrates considered as sugar molecules. Along with other proteins and fats, carbohydrates are a...
Q: The energetic driving force for the synthesis of the new strand is the removal of the pyrophosphate ...
A: Replication is the process by which new Deoxy Nucleoside Monophosphates (DNTP) are added to the 3' e...
Q: Starting with pyruvate (CH3COCOO—) as the precursor, the first step of gluconeogenesis is activatio...
A: Gluconeogenesis is a metabolic process that results in the transformation of non-carbohydrate carbo...
Q: Biological activity of proteins is dependent on which? A. peptide bonds B. thermodynamic properties...
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. Proteins...
Q: Salt bridges are more commonly formed compared to the aforementioned disulfide bridges. Which amino ...
A: A folded protein is stabilized by four types of noncovalent interactions (hydrogen bonding, electros...
Q: Which of the following statements below is true?
A: Rock salt is a halite which is a mineral and form of common salt called as sodium chloride. This mi...
Q: Peptide Concentration (M) 2.5 x 104 5.0 x 104 10.0 x 104 15.0 x 104 Velocity (M/min) 2.2 x 106 5.8 x...
A: Km is the substrate concentration at half vmax.vmax is the maximum rate of reaction catalysed by Enz...
Q: 6. Why would the lack of lactase cause Carol so much distress? Where would the undigested lactose tr...
A: Lactose is the principle carbohydrate present in milk and consists of two sugars, glucose and galact...
Q: the difference between the chemical structures of DNA & RNA and state the said difference in a short...
A: Both the DNA and RNA are made of nucleotides , containing a fivecarbon sugar backbone (pentose) , a ...
Q: Amino acids are: O A. Compounds which may be found only in proteins. B. Organic compounds with at le...
A: Proteins are massive biomolecules and macromolecules made up of one or more long chains of amino aci...
Q: -luginfile.php/7382296/mod_resource/content/0/Purine%20Practice%20Pathway.pdf 1 / 1 67% Purine Synth...
A: DNA and RNA are nucleic acids composed of nucleotides. Nucleotides are composed of a pentose sugar (...
Q: Anımal cells metabolize fatty acids through a series of reactions that convert fatty a These reactio...
A: Answer - In a living organism, the body is covered by skin and beneath of skin a layer of tissue i...
Q: An enzymatic reaction was carried out in a batch-operated reactor until exhaustion of the substrate....
A: Michaelis-Menten equation is used for analyzing the rate of the enzyme catalyzed reactions in a ferm...
Q: All the enzymes that participate in the citric acid cycle are located in the mitochondrial matrix, e...
A: Citric acid cycle - TCA cycle (tricarboxylic acid cycle) leads to release of stored energy via the o...
In DNA extracting.
What is the purpose of clear shampoo in the DNA extraction buffer?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?Close contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?Question. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?
- TRUE OR FALSE. Studies have confirmed that damaged to both the double strands can be reversed via single stranded annealing.True or False. Do single-stranded DNA strands stabilize other strands?Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedure
- Need help ASAP. How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an example with the detail of the disease and the procedure.Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864Please help me with the orange question. My answer is leading strand will encounter lagging strand. I dont know if it’s correct. Thank you
- please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.elearn.squ.edu.om/mod/qu NG SYSTEM (ACADEMIC) Time left 0:44:39 If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. ATATATATCGCGTTAAATTCTA CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose..