Answered: In a workplace, what circumstances…

In a workplace, what circumstances causes health issue and injuries? What actions can be done to prevent such in cindents from happening?

Nutrition Now

8th Edition

ISBN:9781337415408

Author:Brown

Publisher:Brown

Chapter20: Vitamins And Your Health

Section: Chapter Questions

Problem 18RQ

See similar textbooks

Related questions

Q: Do fast

A: Transposons are mainly those genetic elements that have the tendency to move from one place in the…

Q: Give the role of starch solution, phosphate buffer, and NaCI solution in the amylase test. What are…

A: The amylase test is a laboratory test used to measure the level of amylase in the blood. Amylase is…

Q: Do you think these different regional populations are different species that could only occasionally…

A: Introduction A population comprises all the organisms of a particular species in a particular…

Q: Two true-breeding varieties of maize, one 11 cm high and the other 47 cm high were crossed and the…

A: Introduction:- The true breeding plant varieties means that they are homozygous ( genotypically) for…

Q: Which among the following statements is INCORRECT? The first event in the Calvin cycle is the…

A: Calvin pathway occurs in all photosynthetic plants, that is operated in cyclic manner. Calvin cycle…

Q: Which of the following is the advantage to training maximal power production with power lifts? The…

A: A learning curve is a graphical representation of how an individual learns. It typically shows how…

Q: 5. In a given population of diploid individuals, two alleles of gene A exist, A and a. Gene A DNA…

A: Introduction:- PCR ( Polymerase chain reaction) is a biophysical techniques which is used to amplify…

Q: In your own words, give the components of the following body system and the functions of each…

A: The respiratory system is the organs and other parts of our body involved in breathing, when we…

Q: Drag the images/descriptions given to the correct category to assess your understanding of the…

A: Introduction : Bacteria can be categorised in a number of ways depending on their morphology,…

Q: A mutant haploid strain of Saccharomyces cerevisiae (yeast) called cox2-1 was found that was unable…

A: S. cerevisiae is utilized as a prototype in biological sciences to examine conserved processes…

Q: All signaling molecules bind to receptors on the cell surface. Select an answer and submit. For…

A: Ligand molecules are signalling molecules that basically interact with another molecules and…

Q: ㅇㅁㅁ ㅇㅁㅁ 미이 e pedigree shown, indicate whether each of the following inheritance patterns ssible by…

A: Mutation in any of the autosomes or sex chromosomes give rise to different types of inheritance…

Q: explain what does hisatmine and adetycholine mimic. within smooth muscle receptors. what do they…

A: Histamine is an important chemical that has a role in a number of different bodily processes. It…

Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…

A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…

Q: Which one is important for pregnancy women during 1st trimester folate or iron or calcium or protein

A: The time from conception to birthing is referred to as a "pregnancy." It is a condition in which a…

Q: Utilize critical thinking skills to apply the information learned in this lecture. Practice by…

A: The digestive system carries out the physical and chemical digestion of food so that it can be…

Q: In this cartoon, imagine that Romeo is a potassium ion (K+) and Juliet is a sodium ion (Na+).…

A: The plasma membrane of the cell regulates the entry and exit of different molecules according to…

Q: In science, a paradigm is a: a.framework of concepts shared by a community, on which theories are…

A: Introduction A paradigm is defined as a set of theories and assumptions that comprise a worldview,…

Q: exaplin in detail histamine H1 and its links to meyparamine antagonist. Provide mechanims and…

A: The Immune System defends our bodies against infections. Pathogens include parasites as well as…

Q: Whilst bored in the lab, you decide to repeat the Hershey and Chase experiment, only this time you…

A: Hershey and Chase Experiment - Hershey and Chase's Experiment is also called as Blenders Experiment…

Q: how is scanning electron microscopy unique and usefulm what makes this so important?

A: Electron microscopes use a focused beam of electrons to image the specimen while optical microscopes…

Q: A culture consisting of 100 litres of nutrient medium containing 12 g l-1 of growth limiting…

A: Biomass is organic matter that has been recently living or that is capable of decomposing to release…

Q: ㅁㅇ PTO 어어어어어어어 In the pedigree shown, indicate whether each of the following inheritance patterns is…

A: Some genetic abnormalities have an inheritance pattern known as autosomal recessive. A gene is…

Q: ist the inhibitors and activators of the Pyruvate Dehydrogenase Complex observed in most species?

A: Pyruvate dehydrogenase (PDH) complex is a multi-enzyme complex and catalyzes conversion of pyruvate…

Q: URGENT. PLZ HELP.

A: Arginine is an important amino acid that makes up the protein. The protein is made up of a sequence…

Q: Whare are five general reasons why scientists conduct surveys

A: A Survey is a study of behaviors, opinions, and needs of a particular group of people. In a survey,…

Q: ㅇㅁ ㅁㅁ 이미 ㅇㅇㅇ 움 In the pedigree shown, indicate whether each of the following inheritance patterns is…

A: The given pedigree has the following features: i) skips generation: affected children have both…

Q: Slime molds are ususual in their lifestyles and apperance. You might have seen one and not even…

A: Molds are tiny fungi that consume plant or animal substances to survive. Nobody knows how many…

Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…

A: Introduction : MIC is the minimum inhibitory concentration of the antimicrobial agents to inhibit or…

Q: Diabetes type .....is characterized by.....effectively be managed by diet and exercise. 1 (one); an…

A: Diabetes is a chronic illness brought on by either insufficient insulin production by pancrease or…

Q: The High Mobility Group (HMG) proteins are architectural regulators of DNA. Many HMG proteins are…

A: The question asked is how phosphorylation effect the binding affinity of HMG proteins to DNA.…

Q: The term taphonomy refers to____. a. the classification of organisms in relation to each other b.…

A: Evolution is a steady phenomenon in which transformation of life takes place from simple to complex…

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction : The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: How is dopamine and glutamate connectivity altered in the brains of schizophrenics?

A: In schizophrenia dopamine release is impaired. It means in schizophrenic patients the level of…

Q: Use the Hill Equation to determine the fractional saturation of hemoglobin in equilibrium with blood…

A: The phrase "fractional saturation" relates to the FO2 Hb, that is the portion of total haemoglobin…

Q: Based on the group it belongs to, which of these land plant innovations are possessed by Ferocactus…

A: The plants comes under kingdom plantae. Ferocactus wislizeni comes under clade angiosperm. Being…

Q: All mutations in mitochondrial genes ultimately affect (whether directly or indirectly) the key…

A: Introduction: It goes without saying that the primary purpose of mitochondria is to produce ATP.…

Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…

A: Each bacterial isolate-antibiotic combination is given a Minimal Inhibitory Concentration (MIC). The…

Q: Briefly explain why having a forelimb lever with high MA is potentially advantageous.

A: Introduction : One of the paired articulated appendages (limbs) attached to the cranial (anterior)…

Q: What is the role of NAD+ and FAD in the breakdown of glucose?

A: INTRODUCTION Glucose Glucose is a simple sugar molecule that act the main source of energy in our…

Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…

A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…

Q: Chapter 10 of your textbook describes four biogeochemical cycles (some of which might also be called…

A: The major biogeochemical cycles are pathways by which nutrient flows between abiotic (lithosphere,…

Q: You ran the agarose gel but forgot to include the lactose-induced 23S reaction (template - cDNA).…

A: If there were white colonies in the plate, then the recombinant clone was created if blue then it…

Q: What is the description of the growth and growth pattern of the microorganisms in the spread plate…

A: -A quadrant or T streak plate is used to maintain or obtain a pure culture of a bacterium. A type of…

Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: The Upper Paleolithic / Later Stone Age includes____ that are characterized by____. a. Mode Ill…

A: Introduction: In later stone age is actually upper paleolithic the modern human moved…

Q: DNA, which is negatively charged, can adsorb onto the surface of citrate-capped Au nanoparticles.…

A: Langmuir adsorption isotherm describes the situation of equilibrium between the two systems…

Q: Which among the following is not a raw material of light dependent reactions of photosynthesis?…

A: Please follow step 2 for detailed explanation.

Q: When making bread with common yeast, the reaction starts as an aerobic process and then becomes an…

A: The bubbles obtained in the bread is the result of the formation and collection of gases such as…

Q: All of the following regarding ribosomes are true EXCEPT: A. Ribosomes are comprised of protein and…

A: The answer is option c. All of the following regarding ribosomes are true EXCEPT ribosomes bind…

Concept explainers

Human Movement

Humans can move from one place to another through coordinated movements and postures. The movement produced by the human body due to the contraction of muscles and bending of bone joints is called human movement. Human movements are controlled by the nervous system. Hence, the human movement incorporates the use of muscles, ligaments, joints, and bones. Kinesiology is the field that deals with the study of human movements.

Question

In a workplace, what circumstances causes health issue and injuries? What actions can be done to prevent such in cindents from happening?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Inflammation of more than one joint is known as._________________
A ___________________ is a physician who specializes in diagnosing and treating dis- eases and disorders of the skin. dermatologist dermatology neurologist neurology
A 53-year-old female patient, suffers from joint pain especially in cold mornings. The joints are swollen and have a “gritty” feeling inside. What clinical impression do you have of the patient? Rationalize. Thank you for your help.
Define brush border
In the joints, cushion areas where tendons or ligaments rub are called
You saw a lady who was hard hit by a motorcycle. She readily fell on the ground and became unconscious. The victim acquired a laceration, about 4 inches in length, at the left crus and a broken left pollex. The motorcycle driver on the other hand fell on the ground, conscious, and acquired a large abrasion on the right olecranal area. You and some bystanders have witnessed the accident. What will be your response? Assume that you are a licensed first aider and you have all the materials needed with you.
A neurosurgeon orders a spinal tap for a patient. Into what body cavity will needle be inserted?
identify the animal structures for support, protection, and movement Support Outer Covering/Integument Movement/ Locomotion Sponge Coral Earthworm Mussel millipede spider/crab bony fish pigeon cat
James and his friend Kevin were riding their bikes along the bike path when they stopped to look at something in the water. They wanted to take a closer look so they got off their bikes and began cimbing on the rocks to get a better view of the object. All of a sudden James let out a loud scream and Kevin noticed his friend was having difficulty walking. Upon assessing the injury, he noticed a deep, narrow wound in his foot. This type of wound is known as: O a Abrasion O b Puncture Laceration Amputation
For good tendon healing to take place, there needs to be a high level of elastin. True or False
A 22-year-old female patient arrives in the emergency department after a skiing accident. She was going downhill quickly when she twisted, fell, and reports hearing and feeling a "pop" in the right knee. The ED physician has diagnosed her with an ACL year and refers her to the orthopedic surgeon for arthroscopic repair. Can ligaments be repaired? If so, explain how and provide examples.
The vertical depression that is located inferior to the columna nasi and on the medial plane of the superior integumentary lip is known as the A. medial lobe B. labial sulci C. line of closure D. philtrum