If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA code?

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: Why is it that pre-mRNAs are capped, but tRNAs and rRNAs are not?

A: Ribonucleic acid (RNA) is a polymeric molecule important in various biological roles such as…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: Demonstrate the consequence on following translation of the insertion of an adenine base to the…

A:

Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…

A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Aminoacyl-tRNA synthetases are the only component of gene expression that decodes the genetic code.…

A: The protein synthesis involves the synthesis of the polypeptide chain which is catalyzed by several…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: How does C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA…

A: RNA polymerase II is a multiprotein complex that transcribes DNA into precursors of mRNA and…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are amino acid chains that forms the various protein molecues in our body. These…

Q: If a DNA sequence (exons and introns) and the regions upstream/downstream are normal -- but no mRNA…

A: During RNA splicing Introns are removed and Exons ligated together to give rise to a functional RNA…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: ollowing is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the…

A: mRNA is the polymer of nucleotides formed by the process of transcription using the DNA template…

Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…

A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: A substitution mutation that results in the formation of a stop codon and premature termination of…

A: Mutations are the alterations or the change that occur in the DNA. Mutagens, like ultraviolet…

Q: Why is it advantageous to have a mechanism to override the effect of stop codons in protein…

A: In the central dogma,  the Ribonucleic acid (RNA) is formed from the template of Deoxyribonucleic…

Q: How would protein synthesis be affected ifa single codon could specify the incorporation of more…

A: Ambiguous codon is the codon that codes for more than one amino acid.

Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…

A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: If the DNA triplet is TTA, then the transcribed MRNA codon would be

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'

A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…

Q: What is the "genetic code" and what aspect of post translational modification virtually mandates…

A: Genetic code is a set of rules followed by every living cell by which information stored in genetic…

Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…

A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…

Q: Which of the following RNAS is the product of transcription?

A: Transcription is the process of making an RNA copy of a gene sequence

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: How would you make a copy of DNA from an mRNA transcript,what is this molecule called, and how would…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?

A: A ribosomal binding site is a sequence of nucleotides upstream of the start codon of an mRNA…

Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…

A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…

Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…

A: Introduction DNA:-  (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid?  a. E b. K c.F d.L

A: Dear student answer of your question is given below:  Given codon in the mRNA is 5' GAA 3' ,  It…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?

A: m-rna is synthesized in 5' to 3' direction and it used the enzyme rna polymerase and dna template…

Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…

A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…

Q: What would be the effect of a mutation that eliminated the downstream 3′ splice site at the end of…

A: In eukaryotes, genes are distributed in form of non-coding regions called introns and coding regions…

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.