If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate different proteins? What are the 3 tRNA sites on the small ribosomal subunit (just abbreviations)? What is the order of tRNA entrance and exit through the ribosome?
Q: Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think…
A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…
Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…
A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…
Q: What does the A site on the ribosome do? What does the P site on the ribosome do?…
A: The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins that functions as…
Q: Which enzymes and tRNAs are known as aminoacyl-tRNA synthetases?
A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…
Q: Define the following terms: genetic code, codon, and anticodon. What is the relationship among the…
A: DNA is the storehouse of information in living organisms. It is present inside the nucleus of every…
Q: How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying…
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…
Q: Name the enzyme responsible for binding of aminoacid to trna?
A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…
Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…
A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…
Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…
A: The genetic information flows from the form of DNA into the form of protein and this framework is…
Q: What are Cyclin and mRNA? How are they related?
A: Cyclins get their name from the fact that during cell division, they go through a continuous period…
Q: How does it improve the efficiency of protein synthesis to have several binding sites for tRNA close…
A: Translation is the process by which a protein is synthesized from the information contained in a…
Q: Describe what is the function of the anticodon of a tRNA?
A: The biological instruction manual known as DNA, sometimes called deoxyribonucleic acid, provides…
Q: What are the function of initiator Trna?
A: Initiator tRNA is the tRNA that brings the first amino acid for the synthesis of proteins.
Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…
A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…
Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?
A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…
Q: What is the minimum number of tRNA molecules that a cell must contain in order to translate all 61…
A: A transfer RNA is adaptor molecule composed of RNA having 76 to 90 nucleotides in length.
Q: What are the two main steps to protein synthesis and where do they take place? What are the…
A: Dear student, as per our honour code, we are allowed to answer only one question at a time. Please…
Q: What are the three functional parts of the tRNA and what is their importance to translation?
A: Transfer RNA or tRNA generally contains 76-90 nucleotides and acts as a physical link in between…
Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…
A:
Q: How do the stop codons UAA, UAG, and UGA know to form? What if a protein stops synthesizing too…
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…
Q: Give the structure of Trna,the adapter molecules?
A: An adaptor molecule is typically a "bridge" between other molecules, often one which allows…
Q: an anticodon on one end and a site for an amino acid to attach on the other end. There is base…
A: Translation :- It is the process by which a protein is synthesized from the information contained…
Q: Each tRNA has unique identity elements recognized by its specific enzyme involved in charging it…
A: Transfer RNA (abbreviated tRNA and formerly referred to as sRNA, for soluble RNA is an adaptor…
Q: Can the same enzyme esterify more than one amino acid to its corresponding tRNA?
A: Aminoacyl transferases are the enzymes which are responsible for the attachment of the main acid to…
Q: In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A.…
A: Ribosomes are small and round bodies that are either found floating freely in the cytoplasm, or…
Q: What is the "genetic code" and what aspect of post translational modification virtually mandates…
A: Genetic code is a set of rules followed by every living cell by which information stored in genetic…
Q: In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a…
A: DNA or deoxyribonucleic acid is a double-helical molecule consisting of two polynucleotide chains.…
Q: Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?
A: Protein synthesis involves translation of mRNA into a protein that requires three complex stages,…
Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…
A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…
Q: What is the function of the anticodon of a tRNA?
A: tRNA is basically a messenger molecule that helps in decoding of mRNA and helps in the formation of…
Q: What two different things bind to the two different ends of a tRNA molecule?
A:
Q: When translation begins, the first amino acid heads to the small subunit of the ribosome. What…
A: The translation is a process in molecular biology whereby the cell reads information from messenger…
Q: What would be the tRNA anticodons for the mRNA in question 3
A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .
Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…
A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…
Q: What are the rules that govern the recognition of a codon by the anticodon of a tRNA?
A: The translation is the process of protein synthesis that occurs in the cytoplasm, in the presence of…
Q: What are the two key functional sites of a tRNA molecule?
A: tRNA (transfer ribonucleic acid) is the type of RNA molecule that takes part in translation of…
Q: Why does a bacterial mRNA bind specifically to the small ribosomal subunit?
A: The ribosome is a very complex structure, whose machinery is broadly divided into larger and smaller…
Q: The RNA molecules that bring a specific amino acid to the ribosome is the?
A: The process of translation occurs only in the presence of RNA (ribonucleic acid) molecule and…
Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…
A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…
Q: Which translation protein mimics RNA structures and why?
A: Gene expression is defined as the process of conversion of information stored in the DNA to the…
Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…
Q: If the amino acid serine attaches to a tRNA, which of the following anticodons could be at the…
A: tRNA tRNA or transfer RNA is a Kind of RNA molecule that decode the code of mRNA and brings amino…
Q: Which part of a cell is the tRNA produced?
A: The transfer-RNA or tRNA is an mRNA molecule that is about 90 nucleotides long. It mainly functions…
Q: Match each term with the most appropriate description. sites for polypeptide assembly binds to…
A: All cells have the translation process resides within a specialized organelle which is known as the…
Q: How is ATP used to charge a tRNA?
A: Adenosine triphosphate (ATP) is an energy source required to the body to perform various cellular…
If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate different proteins?
What are the 3 tRNA sites on the small ribosomal subunit (just abbreviations)? What is the order of tRNA entrance and exit through the ribosome?
Step by step
Solved in 2 steps
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidWhich part of a cell is the tRNA produced?How does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.
- Which amino acid would be attached to a tRNA that read "GGU"?Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for removing them?How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying an incorrect amino acid?
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)How does it improve the efficiency of protein synthesis to have several binding sites for tRNA close to each other on the ribosome?
- A tRNA has the anticodon sequence 3′–CAG–5′. What amino acid does it carry?If the mRNA transcribed for this gene will be translated into a functional protein, how many amino acids will be used to build the polypeptide chain? what is the amino acid coded by the 25th codon? what is the amino acid coded by the last codon?For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.