ich of the following answers are true about adenosine triphosphate (ATP)? Note, there may be MORE THAN ONE correct answer, please choose all that are correct. ATP supplies the energy for most cellular processes ATP can be broken down into ADP + Pi ATP breakdown can be coupled to a reaction that requires energy ATP breakdown is an endergonic (energy-requiring)
Q: The image attached is a drawing of a Columnar Epithelium slide with the 40x objective lens. There…
A: The lining of the digestive tract (stomach, small intestine, and large intestine), the respiratory…
Q: AA AS SS otal viduals in these individuals in these individu
A: Population genetics includes the study of genotypic and allelic frequencies within a population.
Q: A simple diagram indicating the alterations in genetic content throughout mitosis could be prepared…
A: Mitosis is the cell division process that is responsible for the production of two diploid (2n)…
Q: Several rounds of failure often precede most successful scientific discoveries. How did failure play…
A: James Watson and Francis Crick made one of biology's most significant discoveries—the discovery of…
Q: What is a potential reason as to why intracellular calcium levels increase even after a…
A: Neurons are the cells of the nervous system that are responsible for the generation and conduction…
Q: Which of the following is NOT true about enzymes? Enzymes are proteins Enzymes raise the…
A: In living things, enzymes serve as catalysts that are biological molecules, usually proteins. They…
Q: In the pedigree below what is the expected mode of inheritance?
A: Pedigree analysis helps us to understand the mode of inheritance of a particular trait (disease) by…
Q: external lactose cell membrane on RNA polymerase promoter lactose permease B-galactosidase…
A: Genes that are connected to one another, such as those participating in the same metabolic process,…
Q: *Cystic fibrosis is a rare autosomal recessive condition. A phenotypically normal man whose father…
A: Mendel proposed three laws based on his research. His research provided a picture of the independent…
Q: Why do infants from developing countries lag behind in their growth compared to infants from…
A: In analyzing the growth disparities between infants in growing nations and those in evolved…
Q: In most species containing individuals that are either male or female, the proportion of males and…
A: Fitness is a numerical representation of an individual's reproductive success in population models.…
Q: In many types of tumors, the genomic DNA methylation pattern is changed either through…
A: Out of the options listed in the question, most promising potential cancer therapy that can restore…
Q: A, B, and C are all examples of what general class of biomolecule? Please specify the correct…
A: We are given the image of the cell membrane and we need to identify the biomolecules attached to it.…
Q: Certain cells in your pancreas make digestive enzymes that are secreted into ducts and carried to…
A: The pancreas is an abdominal organ located behind the stomach, surrounded by the spleen, liver, and…
Q: See image
A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Which of these events is most likely to result in the generation of a new species of horsetail? A.…
A: Horsetails, a kind of non-flowering vascular plant, have a fascinating evolutionary history that…
Q: In biology, the phrase "form fits function" is often used to describe the relationship between a…
A: Cell organelles are the cellular components. These cell organelles comprise both membrane and…
Q: This is a picture of a plant that grows in the tundra with the common name arctic willow. Plants…
A: The tundra is an ecosystem characterized by extremely cold temperatures, low precipitation, and a…
Q: Which of the following statements is TRUE about the topologies of the trees shown below? All four…
A: A hybrid network architecture known as a tree topology, or star-bus topology, connects star networks…
Q: abel the diagram by dragging the labels to the appropriate targets. DNA's secondary hydrophobic…
A: DNA or deoxyribonucleic acid contains the hereditary units called "genes" that carry information…
Q: Which of the following microscopy techniques can be used in live cell imaging in a live animal. 1.…
A: Live cell imaging within live animals is a vital facet of contemporary biological research, enabling…
Q: Which of the following include the correct order of phases of a typical bacterial growth curve? log,…
A: Microorganisms grown-up in closed culture also called as a batch culture in that no nutrients are…
Q: 5. Now determine the total magnification of the letter "e" that you are looking at using this…
A: The light microscopes are routinely used in biological laboratories. There are two types of light…
Q: can you explain the mechanisms that control the activity of enzymes?
A: Enzymes are biological enzymes that catalyze (enhance) chemical processes in living organisms.…
Q: Scientific name (Genus species) - This must be formatted correctly. If your group includes more than…
A: Primates are a diverse order of mammals characterized by features such as forward-facing eyes,…
Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…
A: In the context of nutrition and dietary science, it is essential to understand the energy content of…
Q: What is osteoarthritis
A: The skeletal system is the support system of the body that provides shape and structure to the body.…
Q: Which of the following result do you expect to see from your experiment, and what problem you may…
A: Immunity is the term used for the ability of our body to fight against pathogens. Immunity is of two…
Q: Determine the type of hemolysis displayed on this blood agar plate. Drag the appropriate label to…
A: Red blood cell destruction is referred to as hemolysis. Some microbes are categorized based on their…
Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…
A: The correct answer is option D. Sex-linked recessive.
Q: What is the best description for the following tissues (Explain in 1-3 sentences): Description: 1.…
A: One of the four primary forms of bodily tissue, epithelial tissue covers both internal and exterior…
Q: Male and female pronuclei form Secondary oocyte present in oviduct Oocyte activation Meiosis…
A: A crucial biological process known as fertilization occurs when an egg cell containing genetic…
Q: Birds undergo prolonged migratory flights, with some birds flying constantly for hours to days at a…
A: The phenomenon of migration can be described as the regular movement of individuals or groups of…
Q: Which of the following statements about the evolution of life on Earth, from simple prokaryote-like…
A: The evolution of life on Earth is a remarkable process that has led to the development of complex…
Q: 27) If the sequence TCGTA was used as a template in DNA replication, what would the sequence of…
A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…
Q: Why is it necessary to sterilize the loop between streaks when streaking for single colonies?
A: Streaking is a technique used to isolate a pure strain from a single species of microorganism, often…
Q: PTS is associated with a: enzymes that are responsible for peptidoglycan synthesis inductive…
A: The Phosphoenolpyruvate: Sugar Phosphotransferase System, often abbreviated as PTS, plays a crucial…
Q: Nucleosomes aggregate and disaggregate a.through the attachment of ubiquitin. b.through the…
A: Nucleosomes are fundamental units of chromatin structure, consisting of DNA wrapped around histone…
Q: What is the 260/280 ratio when quantifying DNA? select the correct option below A. ratio of protein…
A: Deoxyribonucleotides are joined together by phosphodiester bonds to produce DNA, also known as…
Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…
A: Evolution is the gradual process through which living organisms change over time, typically due to…
Q: Sugar residues that are attached to proteins embedded within the plasma membrane, that play a role…
A: The question pertains to a fundamental aspect of cell biology and the structure of the plasma…
Q: 2. The following is the sequence of a gene encoding a small protein: GG (d) 5'…
A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…
Q: Which of the following is an advantage of confocal microscopy over conventional fluorescence…
A: One significant advantage of confocal microscopy compared to conventional fluorescence microscopy is…
Q: QUESTION 10 The sarcoplasmic reticulum stores ions of: chloride calcium O sodium O potassium
A: The question spins around the function of the sarcoplasmic reticulum in muscle cells. The…
Q: Best techniques for the quick and reliable diagnosis of viral agents in sample and why that…
A: Viral agents can only multiply inside living cells and are nonliving outside of them. They have the…
Q: The electron transport system in bacteria involves: a proton motive force and oxidative…
A: The electron transport system, also known as the electron transport chain (ETC), is a vital process…
Q: How is cigarette smoking related to elastase function? Methionine sulfoxide is formed by cigarette…
A: lastase is an enzyme, specifically a protease, that plays a critical role in the breakdown of…
Q: Many proteins are attached to the membrane phospholipids via a covalently linked polysaccharide.…
A: Glycophosphatidylinositol (GPI) anchors represent a fascinating aspect of cell membrane biology.…
Q: Explain how spider monkeys traits benefit them.
A: Spider monkeys are arboreal primates known for their prehensile tails, which help them swing through…
Q: Describe what kind of pathological evalitations in short term in vivo test you would want to assess…
A: When performing brief in vivo safety assessments for a novel chemical designed for consumer…
ich of the following answers are true about adenosine triphosphate (ATP)? Note, there may be MORE THAN ONE correct answer, please choose all that are correct.
-
ATP supplies the energy for most cellular processes
-
ATP can be broken down into ADP + Pi
-
ATP breakdown can be coupled to a reaction that requires energy
-
ATP breakdown is an endergonic (energy-requiring) reaction
-
ATP is a very stable and low-energy molecule
Step by step
Solved in 4 steps
- What ultimately powers the synthesis of ATP in cells? Group of answer choices Electrochemical potential of ion gradients across membranes Oxidation of fuel molecules Photosynthesis A and B All of the aboveATP is an important molecule in cellular energetics. Which of the following statements is false? ATP hydrolysis can provide the energy required for mechanical work in a cell. All of the ATP made during cellular respiration is made by the enzyme ATP synthase. ATP synthesis is an endergonic reaction. None of the other answers are false.ATP is a source of free energy that drives unfavorable reactions. Which of the processes are coupled to the dephosphorylation of ATP? ion transport with the concentration gradient reversible isomerization of glucose-6-phosphate to fructose-6-phosphate during glucose catabolism the endergonic reaction forming glucose-6-phosphate myosin action during muscle contraction de novo (from scratch) anabolism of nucleotides One reason that ATP is a source of energy is that the products of ATP hydrolysis have less free energy than the reactants. Why? formation of ion pairs involving ATP hydrogen bonding between free phosphate and water resonance stabilization of free phosphate electrostatic repulsion in ATP
- Like many fruits, apples contain not only fructose and glucose, but also sucrose, a dimerof fructose and glucose. Synthesizing sucrose is endergonic and so not spontaneous. Onerole of ATP is to facilitate reactions that would not occur spontaneously. The threephosphate groups are electron rich and tend to repel each other. Therefore, ATP is a bitlike a compressed spring, ready to kick off one phosphate group releasing energy.Consider: Fructose + glucose --> Sucrose delta G= 6.4 kcal/mol ATP --> ADP + Pi delta G= -7.3 kcal/mol a. Draw a simple energy diagram (including the relative energy of the reactants andproducts) that shows why the sucrose synthesis reaction doesn’t occur spontaneously. b. How could having these two reactions occur at the same time help with sucroseproduction? c. Draw the energy diagram that shows all the reactants and products for the combinedreactions. d. What is delta G for the combined reactions? e. Name a few of the biological processes in the body that…Which of the following processes would be directly affected by the presence of a non-hydrolyzable form of ATP ? the depolymerization of tubulin monomers O the depolymerization of actin monomers the polymerization of tubulin monomers the polymerization of actin monomersYou treat cells with 2,4 dinitrophenol (DNP). This compound creates a temporary channel in the inner membrane of the mitochondria though the protons can move. Which of the following would you observe in these cells? Select all that apply The cells do not synthesize ATP in the presence of DNP The cells synthesize ATP in the presence of DNP The cells reduce oxygen in the presence of DNP The cells generate carbon dioxide in the presence of DNP
- Which reaction is most likely to have a positive value for ∆G? Synthesis of a polymer from monomers Hydrolysis of ATP Ã ADP Payoff phase of glycolysis Diffusion of ions from high to low concentrationWhich of the following types of covalent bonds are found in the structure of ATP? Phosphoanhydride, phosphomonoester, N-glycosidic bond. N-glycosidic, thioester, phosphodiester bond. Ester, ether, phosphoanhydride bond Ether, ester, phosphomonoester bond Next 000For each of the following sentences, fill in the blanks with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase may be used more than once. ADP FADH2 H+ moderately protons ATP favorable higher NADH severely cytosol glucose lower NAD+ slightly electrons GTP matrix Pi unfavorable High-energy electrons are transferred through a series of molecules, and the energy released during these transfers is used to generate a gradient of , or . Because their concentration is outside than inside the mitochondria, the flow of , or , down the concentration gradient is energetically very and can thus be coupled to the production of ATP from ADP. Thus, oxidative phosphorylation refers to the…
- Compare the structures of ATP to these nucleic acids: cCAMP, dinucleotides, RNA, DNA. Your comparisons should include both similarities and differences. Your comparisons should:1. Carbon dioxide +Water+ Energy → Sugar + Oxygen 2. Sugar + Oxygen → Water + Carbon Dioxide + Energy the second reaction shown here (cellular respiration), which of these descriptions compares the products and reactants The process produces ADP as a product, which has a lower energy level compared to the reactants. The process produces inorganic molecules only, which have a lower energy level compared to the products. The process produces ATP as a product, which provides a greater cellular energy compared to the reactants. The process produces heat energy as a byproduct, which causes the reactants to be less energetic compared to the products. Carbon Dloxide Production in Snails & Elodea Test Tube Contents Tube A: control Initial Color Light Set Up Dark Set Up green green blue green green areonAnother of the six enzyme classes is which of the following? enzymes catalyze. These classes include the transferases, isomerases, and ligases. All enzymes can be categorized in one of six major classes based on the reactions the proteases kinases hydrolases phosphatases endonucleases An important factor that influences the rate of a biochemical reaction is the temperature. Raising the temperature of a biochemical reaction has which effect upon the kinetics of the reaction? a) b) c) d) e) increases the free energy of the reactants increases the free energy of the transition state decreases the free energy of the reactants decreases the free energy of the transition state decreases the free energy of the products