Q: 3. The fact that the CRA will spontaneously give up its electrons after a certain amount of time…
A: Oxidase test It is a test used to determine the organisms can produce cytochrome oxidase c or not.…
Q: What is the importance of plasma proteins?
A: Introduction In this question we will discuss about the importance of plasma proteins.
Q: Which of the following types of cell is present in the human gastric glands? 1. Mucus neck cells,…
A:
Q: Compare and Contrast Breathing Respiration
A: Breathing and respiration are the major processes that are important for the normal functioning of…
Q: Explain the autoregulatory mechanism of GFR.
A: Introduction In this question we will explain the autoregulatory mechanism of GFR
Q: In humans’ widows peak is inherited by possession of a dominant allele W. If a man who is homozygous…
A: A widow's peak in human, is a V shaped point in the hairline in the centre of forehead. It is…
Q: The bulldog ant has a diploid number of two chromosomes. Imagine a bulldog ant cell is heterozygous…
A: Mitosis is a cell division process that involves production of two diploid (2n) daughters cells from…
Q: importance of plasma proteins
A: Plasma proteins These are blood proteins or the proteins present in the bloodstream. They are of…
Q: Use two different colors to depict the unduplicated chromosomes of species C with larger chromosomes…
A: Carbohydrates, lipids, proteins, and nucleic acid are well stated that are supposed to be an example…
Q: 28. How do regulatory gradients produce many different patterns of gene expression?
A: NOTE: since you have posted multiple questions. So we will be solving the first question for you. As…
Q: Briefly describe the distinguishing organisms and major biological events of the Ediacaran period…
A: Molecular systematics assists biologists in interpreting the fossil record in order to determine the…
Q: male gametophytes
A: The flower of angiosperms (flowering plants) consists of primarily sporophytic tissues, with both…
Q: Q3
A: Phytohormones are plant hormones, non nutritive chemicals that play important role in plant…
Q: What substance is produced by a microorganism that is capable of the growth of other microorganisms?…
A: Antibiotics are medications that are used to prevent and treat microbial infections. Antibiotic…
Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…
A:
Q: III. Mating System. Analyze the mating system of the swine industry as shown in the figure below.…
A: Question A. What would be the expected reproductive performance of F1 crossbred females compared…
Q: Explain why cells need to receive nutrients (explain what nutrients are and give examples).
A:
Q: through cell membranes, explain why all cell types are not sensitive to the presence of 17 beta
A: 17 beta estradiol is formed in the ovaries, testes or adrenal glands. It is made from cholesterol.
Q: A heterozygous free-lobed man is mated to a heterozygous free-lobed woman. What are the genotypes…
A: Genotype is the genetic makeup of an organism. It consists of 2 alleles in an individual.
Q: Under what circumstances could nonhomologous endjoining be said to be error prone?
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: 1. Which of the following group is the most common ancestor of humans and all other vertebrates? a.…
A: Transgenic organisms are also known as GMO (genetically modified organism) whose genetic material is…
Q: Which major organ lies deep to the right hypochondriac region? A. The stomach B. The spleen C. The…
A: An organ is a collection of tissues that structurally form a functional unit specialized to perform…
Q: In humans, ABO blood types refer to glycoproteins in the membranes of red blood cells. There are…
A: There are 4 different blood groups present in the organisms. These blood groups are: A, B, AB and O.…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: Nuclear factor-κB (NF-κB), a transcription factor that is essential for inflammatory responses, is…
Q: 3. a. In the process of converting ADP to ATP, water is circle one: (REQUIRED / RELEASED) and…
A: Adenosine diphosphate(ADP) Important organic compounds in metabolism and is essential to the flow of…
Q: Explain why the nucleotide sequence of the same gene that you inherited from your mother and father…
A: we inherit two copies of each chromosome—one copy from your mom and one copy from your dad. This…
Q: 1. Causes spurious decrease in MCV
A: Cryofibrinogen
Q: Name the components of the formed elements in the blood and mention one major function of each of…
A: Introduction Blood is made up of blood cells and plasma, It is a fluid connective tissue, It is…
Q: Highlight the correct answer to the questions pertaining to the coronavirus 1. A type of virus that…
A: 1. 2 Coronavirus 2. 1 No symptoms of a particular disease
Q: Use the values of the oxygen partial pressure on both sides of the resistance membrane(Po2 = 100,…
A: The pulmonary diffusing capacity for oxygen is the quotient obtained by dividing the volume (ml.) of…
Q: 23. What is the probability that the progeny of a cross between two individuals that are AaBbCCDD…
A: 23) The correct option is B - 1/16
Q: Which of the following evolutionary processes is associated with allopolyploidy? (a) gradualism (b)…
A: Allopolyploid is a term used to describe a type of polyploid. A polyploid person or strain with a…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Describe the conditions that scientists think existed on early Earth.
A: Introduction The origin of life on earth can be traced back to 3.4 billion years ago and as we now…
Q: The technique used in bacteria for endospore staining can also be used to observe fungal spores.…
A: *Endospores staining is used to recognize presence of spore in bacterial cells This needs staining…
Q: The cardiac cycle includes all the events associated with the flow of blood through the heart during…
A: * cardiac cycle is series of events of heart from beginning of one heartbeat to the beginning of the…
Q: 1. Causes spurious decrease in MCV A. Cryofibrinogen B. hyperglycemia C. autoagglutination D. high…
A: Blood indices are certain tests which helps to determine hameoglobin content , size of RBCs…
Q: How would the patient's (lactate/pyruvate] ratio compare to the ratio in a normal infant? O The…
A: Gluconeogenesis is process by which the body generates glucose from non-carbohydrate precursors.…
Q: Highlight the correct answer to the questions pertaining to the coronavirus 1. A type of virus that…
A: Answers of questions regarding corona virus. Note:- According to bartleby guidelines, I can answers…
Q: the heart during a single complete are True/False. The duration of systole exceeds that o
A: The cardiac cycle is defined as the period between the start of one heartbeat to the start of the…
Q: Which test measures percentage of hemoglobin within each red blood cell?
A: Haemoglobin, Hb is the iron-containing oxygen-transport metalloprotein in red blood cells. It is…
Q: Discuss how the social environment contributes to the worldwide DALYS (disability-adjusted life…
A: The act of consuming food in order to assist the body to strengthen its immunity is known as…
Q: when two species exist on the same niche, how is the dominant species affected by the presence of…
A: Ecological niche It is the functional role of any species in a ecosystem or community. In other…
Q: Which tissue delivers dissolved sugar throughout the plant?Read and analyze the question and choices…
A: Plant tissue is a grouping of similar cells that collaborate to perform an organised purpose for the…
Q: In human’s farsightedness is inherited by possession of a dominant allele A. If a man who is…
A: ANSWER;-
Q: Three major phylogenetic groups of Bilateria are currently recognized: Ecdysozoa, Lophotrochozoa,…
A: Since the drastic reorganisation of the phylogeny of the animal kingdom into three major clades of…
Q: Explain the autoregulatory mechanism of GFR.
A: GFR stands for glomerular filteration rate is a first step in urine formation. In urine formation…
Q: 1. What substance is produced by a microorganism that is capable of the growth of other…
A: Question 1. What substance is produced by a microorganism that is capable of the growth of other…
Q: Can I genetically transfer thermopiles into strawberries so it can grow in warm weather?
A: The question has asked whether genes from thermophiles can be transferred to strawberries (plants)…
Q: 1. Biolistics: plant tissues; heat shock treatment: _______ a. mammalian cells b. viruses…
A: 1) Answer : Biolistics: plant tissues; heat shock treatment: ____bacteria___ Chemically prepared…
Step by step
Solved in 6 steps
- In the time of Darwin the results of Mendel’s research on biological inheritance had not been published, Genetics was not yet developed, neither DNA nor the concept of genetic mutation were known. What is the modern darwinist theory that incorporates these bodies of knowledge?What is meant by biological evolution?Based from your discussions regarding the merits and demerits of the various evidences of evolution, what would be your top 5 evidence if you are going defend it to a person who questions the validity of evolution? How would you convince him/ her of the validity of evolution?
- What is the main theory opposed to evolution?What is the theory of Darwinism?What did Darwin propose as the mechanism of evolution?In 1973, biologist Theodosius Dobzhansky wrote an essay titled “Nothing in Biology Makes Sense Except in the Light of Evolution.” Why is evolution so important for understanding biology? Explain your answer in 1–2 sentences.