Q: Stru
A: Introduction: Bones are formed of a variety of cells, proteins, minerals, and vitamins and are…
Q: Compare and contrast viruses’ Lytic and Lysogenic replication cycle
A: Viruses are small infectious agents that only replicate inside the living cells of other organisms.…
Q: What is a sarcomere? What is labeled Z,H, and M, and what are their functions? In the contracted…
A: introduction:- Muscle fibres are specialised cells that make up the muscular system. Its ability to…
Q: Why do you think that samples from urine should be tested within 2 hours of collection, or if not…
A: Introduction : The metabolic and systemic abnormalities are revealed by urine analysis. The…
Q: Compare and contrast biovars, morphovars and serovars.
A: Introduction :- Biovars are variants of a microorganism that have different metabolic…
Q: gentic drift is A. genetic change in an indivdual's lifetime b genetic change over time c. The…
A: The analysis of genes, including how they function inside cells and how they are passed down from…
Q: Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the…
A: In genetics, the laws of Mendelian inheritance determine the likelihood of inheriting a particular…
Q: What is the expected frequency of Gg while in Hardy-Weinberg Equilibrium if you have an allele…
A: Introduction : According to the Hardy-Weinberg principle, allele frequencies in a population are…
Q: A population of mealworm beetles (Tenebrio molitor) called the founder generation-consisting of 150…
A: Introduction :- Mutation is a change in the DNA sequence of a gene or chromosome. It is a natural…
Q: What is the role of the tonsils
A: Introduction : In vertebrates, lymphoid organs, lymphatic vessels, and lymphoid tissues make up the…
Q: The main current options for vector control are the following. Describe each of these methods. a.…
A: A vector is usually a carrier organism, that carries the disease agent and transmits it to healthy…
Q: 4. What four main molecular components make up a phospholipid like phosphatidylcholine? (Note: if…
A: Introduction : Organic molecules that are insoluble in water are referred to be lipids. These…
Q: How many different types of gametes can be produced by the genotype DdEeFF?
A: Gametes are reproductive cells that are produced by meiosis. Sperm is the male gamete and egg is the…
Q: 3. What health teachings can you give to the donor of the fecal sample who was found to have these…
A: The donor of a fecal sample has been found to have parasites, which can cause a range of health…
Q: The diffusivity of amino acids in polyacrylamide gel is approximately 1x10^-9 cm2./s calculate the…
A: Introduction Electrophoresis is a technique used to separate and analyze charged particles, such as…
Q: Careless Kris is using the microscope for the first time to look at cells and breaks a slide at high…
A: Introduction :- An objective lens is a type of lens that is located on the microscope near the…
Q: Kindly in
A: Introduction: The process of transcription involves copying the genetic data contained in DNA into a…
Q: Centromeres of a single homologous chromosome are pulled to opposite poles during
A: Introduction :- Centromeres are a region of a chromosome that play a crucial role in cell division.…
Q: our plasn igest tub
A: Introduction: A plasmid is a small, circular, double-stranded DNA molecule that is separate from a…
Q: In the summer time, the infectious diseases department received 3 patients who were resting on the…
A: Introduction :- Leptospirosis is a bacterial infection caused by the bacterium Leptospira. It is…
Q: In a population of yellow mushrooms, a mutation resulted in a new purple type of mushroom that…
A: Introduction :- Non-random mating occurs when individuals in a population choose mates based on…
Q: or F Edge habitat always provides differential access to one habitat t
A: Introduction: The ecological response to habitat refers to the changes in species composition,…
Q: draw a punnett square for ggBB and GGBb.
A: The genotypes of an individual refer to the arrangement or the type of gene combination that an…
Q: In the below pedigree, the white square in Generation I indicates the heterozygous genotype of Ww…
A: Given in question is a pedigree chatt which shows affected individuals by black colour carriers by…
Q: research medical conditions? Can you explain the technology distinctions between face-to-face and…
A: Today web or internet offers each and every type of information ready on the platter. It is upon the…
Q: sheets are less likely to form than α helices during the earliest stages of protein folding. Explain…
A: The stability of the Alpha helix is affected by the electrostatic repulsion between amino acid…
Q: Taymera Date: 2/1 1. Organisms need. 2. What do limiting factors do a. Separate biotic factor:
A: Introduction: Biotic factors refer to the living components of an ecosystem, including all living…
Q: The Microscope: Care and handling A. Introduction B. Principle C. 3 Use AND STATE 3 USES…
A: Microscope is a device that magnifies small objects, giving the user a close-up view of minuscule…
Q: What are the types of stimuli can be used in stimulating tissue * Name and define the types of…
A: Introduction Tissue is a group of similar cells and their extracellular matrix (ECM) that perform…
Q: You said option c but in your explanation you are stating all are true. wouldn't it be all of the…
A: Introduction :- An ecosystem refers to a community of living and non-living components (such as…
Q: In this assignment, you will write a paper describing the following processes: o DNA Replication o…
A: Central dogma is the very fundamental process in every cell.This is basically a process of producing…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: What is the calculated “critical value” for this problem?
A: Hypothesis testing is the first step in any experimental research. At this step, two types of…
Q: What would be the genotype(s) and phenotype(s) of the offspring when a heterozygous corn plant is…
A: Punnett Square is a chart that displays the genotypes of offspring from a genetic cross.…
Q: The diversification of Cichlids after the formation of Lake Malawi over 2 million year ago is an…
A: Adaptive radiation.
Q: 2. How can parasites (helminths & protozoa) be possibly spread from an infected person to healthy…
A: The term "parasite" refers to an organism that depends on its "host" in order to survive. Some…
Q: A scientist placed a sample of yeast, a heterotrophic single-celled eukaryote, in a closed test tube…
A: Introduction :- Yeast is a type of single-celled fungus that belongs to the Kingdom Fungi. It is a…
Q: Discuss the role of Public Health at the community and national levels. Identify what you believe…
A: Public health is the branch of medicine concerned with improving the health of communities and…
Q: Give two exa
A: Introduction: A disease is a condition that affects the normal functioning of an organism and can…
Q: explain the following: P→ Parental generation. G → Gametes. F1→ First filial generation. F2→ Second…
A: Here the phenotye choosen is stem length. Long stem length is dominant over short stem length. Let L…
Q: Draw the spectrum of pure DNA at the concentration of 50 ug/ml on the graph provided. List all…
A: Introduction: The genetic material that contains the instructions for the growth and operation of…
Q: What is the difference between natural and artificial selection? Natural selection is rare Both lead…
A: Introduction Selection in evolution refers to the process by which certain traits are favored and…
Q: 29d e f h please
A: Introduction: Energy and metabolism are closely related concepts in cellular biology. Metabolism…
Q: 21. What would be the outcome of cells expressing a key tricarboxylic cycle (TCA) enzyme lacking an…
A: The Krebs cycle also referred to as the citric acid cycle or the TCA cycle is a crucial metabolic…
Q: provide study and literature about aquaponics use google scholar for articles questions: 1. why…
A: Aquaponics is a method of farming where fish and plants are grown together in a closed-loop system.…
Q: The figure below shows a comparison between humans (Homo sapiens) and each of the listed species for…
A: Introduction :- The mitochondrial genome refers to the complete set of DNA located in the…
Q: 4) Looking at the epiphyseal plate, what zone is responsi new bone cells: a) zone of maturation and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: he stru
A: Introduction: Anatomy is the branch of biology concerned with the study of the structure of…
Q: b) What is the pH of each of the following solutions? i) [H] = 0.000001 [H*] = 10-3 ii)
A: Introduction : The measurement of hydrogen ion concentration present in the solution is known as…
Q: 23a. If two proteins are functionally homologous then what does that mean about these proteins?…
A: Introduction : Proteins are large macromolecules having one or more polypeptide chains. A…
how many uL do i need to get 1ug of Dna?
absorbance: 260
DNA: 1.05
Concentration: 20.4 ug/ml
Step by step
Solved in 2 steps
- Joshua needs 150mL of 1X TBE buffer. The stock of TBE Buffer is 15X. How much 15X TBE buffer should he use to make 150mL 1X TBE buffer? O 5mL 25mL O 10mL O 15mL O 20mL O o o oArial 5 of 10 761 words Aav Po BIUab x₂ x² A.A. 2. Identify the following structures when given images such as the ones below: ● process of transcription process of translation ● ligands • receptor proteins (in either the cell membrane or in the cytoplasm or nucleus) ● nucleus ● ● nuclear membrane nuclear pores ● ribosomes ● ● DNA mRNA ● tRNA • growing polypeptide chain EX English (United States) AaBbCcDd Ee Normal mana | AaBbCcDdl No Spacing MacBook Air | AaBbLCUC Heading 1 Heading 2 Focus E F Title E Styles Pane IDesign Layout References Mailings words ● ● Endocrine System Part 2 Lecture-OBJECTIVES FOR PRE-LECTURE QUIZ #2 ● 1. Recognize the following types of biomolecules when given images such as the ones below and on the next page: ● glucose (which is a monosaccharide) ● triglycerides ● Review phospholipids DNA ● RNA view • X English (United States) Add Pen OFF Draw with Trackpad polysaccharide amino acid protein (recall a protein with less than 50 amino acids can also be called a peptide whereas a protein with 50 or more amino acids can also called a polypeptide) steroids DNA MacBook Air I Focus Page 2 of 10 ER
- PAYS- DASO บบบ 1 UUC UUA UUG CUU CUC CUA CUG U '} GUU GUC GUA GUG PHE LEU AUU AUC AUA AUG MET or START LEU ILE VAL UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAC} TYR UAA UAG } STOP CAU CAC CAA CAG} AAU AAC AAA AAG J HIS GLN ASN LYS GAU ASP GAC GAG GLU UGU CYS UGC UGA} STOP UGG TRP CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG ARG SER ARG GLY SCAR SCAG АSELIWANOFF'S TEST You can use this as your reference : https://youtu.be/rKng5-ij6kQ9201703 aitavia bns standzus omne ledet avode margsib ad: nf is Lari valab ni aidaxo babivong magsih art griau nont (d al gastos to sengug il blow weig 100 etantadija-emysne stb sew to rotse olup warb vies (5 563 is isbom ysx 8. Define, give an example of, and explain both Catabolism and Anabolism.
- The doctor ordered Pepcid 20mg. You have a vial labeled Pepcid 40mg/5ml. How many ml will you give?Milligrams 47.0 milligrams = Multiple Choice 0.47 decigrams 4.7 centigrams 0.047 grams 0.00047 hectograms All of the answer choices are correct.On hand you have Codeine 30mg tablets. The physician orders Codeine 60mg. How many tab should you give?