Q: For below problem, consider a diploid cell that contains three pairs of chromosomes designated AA, B...
A: The survival of living beings necessitates continuous multiplication. Cell division is required for ...
Q: which of the following is true of chemical signals? - they can only be perceived by the intended re...
A: Chemical signals utilise different neurotransmitters or chemicals( hormones) which act on the intend...
Q: Compare the advantages of Linnaean and phylogenetic classification systems
A: Introduction: Classification is a very important aspect of Biology. It has greatly eased the study o...
Q: female nurses in their forties who don't drink with
A: Vaccine: It is substance which triggers the bodies immune system against a particular disease.
Q: Gyraulus convexiusculus is the first intermediate host of: * Echinostoma ilocanum Fasciola hepatica ...
A: Parasites: A parasite is a creature that lives on or in its host and feeds on or at the expense of t...
Q: the
A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic acid...
Q: Question:- Explain how CO,-in dependence of light –regulates the transition to flowering. Include th...
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...
Q: Illustrate the Parental and F1 cross
A: Trihybrid cross is between the two individuals of a species for studying inheritance of three pairs ...
Q: List the sequences of RNA that would be transcribed from the following DNA template sequences. TTAC...
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that ...
Q: Identify the statement below that is the MOST TRUE O All personality traits are equally heritable.
A: Personality traits are those which we acquire during our lifetime.
Q: 21. Based on their shape and arrangement, identify the type of microbes.
A: Bacteria can be termed as group of prokaryotic, unicellular living beings that can be found in sever...
Q: What is microbial community?
A: Answer :- Microbial community group are gatherings of microorganisms that share a typical living spa...
Q: Which type of biome is found at the lowest latitudes? A. Rain forest В. Desert C. Chaparral D. Tundr...
A: 3. Option A. Is correct Tropical rain forests are found in areas near the equator. Deserts, on the ...
Q: What additive ingredients are thickeners? Total Fat Sat. Fat Cholesterol Sodium Total Carbohydrate D...
A: Out of the option given all are used as thickeners except caramel colour. Caramel colour is a sugar ...
Q: What does phylogenetic classification involve?
A: Cladistics is the most popular method of adding data into phylogenetic trees. Cladistics are theorie...
Q: which cellular function is performed by only some types of cells? obtaining nutrients and chemical ...
A: Cells must perform functions in order to support and maintain life, that is cellular functions, such...
Q: One of the major findings of this study is that GTP arrests the enzyme. Draw (i) the natural substra...
A: Enzymes boost the rate constants of chemical reactions that would otherwise be hundreds of times slo...
Q: What are the 4 mode types of disease? Explain each
A: Health is defined as the state of physical, mental and social well being. Disease refers to a condit...
Q: Question: Can two people have the same DNA?
A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of DNA is unique to all individuals. ...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: The solubility in water of molecules is the tendency of molecules to gets dissolved in water. The ch...
Q: How can you reply to a discussion about animals with special adaptations?
A: The "Ecosystem" is comprised of the interactions of species in a given region with their surrounding...
Q: This image is of the very back of the eye. Light would be coming in from the left towards the right ...
A: Eyes are organ that is responsible for vision. The eye ball is located inside in the bony orbit and ...
Q: 14. A previously well 18-year-old girl is admitted to the ICU because of altered mental status. She ...
A:
Q: write a short description to explain the morphology of graphide, styloid , prism , druse and crystal...
A: The above-mentioned terms infer the different shapes of Calcium oxalate crystals that are widely fou...
Q: Do Gram-negative bacteria grow on PEA agar? If not, what prevents their growth?
A: ANSWER;-
Q: 2. Describe the phenotype of individuals who inherit two copies of the Hbs allele Sickle-Cell Diseas...
A:
Q: A solute cannot move into a cell by crossing the phospholipid bilayer of the membrane. It can, howev...
A: Plasma membrane is a bilayer structure composed of phospholipids that has different proteins embedde...
Q: select the following answers
A: Since, individual 1(male a/c to the pedigree diagram) is phenotypically healthy and female 2 is dise...
Q: The phenotype of individuals heterozygous for_____ alleles comprises both homozygous phenotypes. a. ...
A: Individuals in the population each have a unique set of alleles known as their genotype. Genotypes i...
Q: Question 8 What causes eyeshine in some animals like cats? O a reflective layer at the back of the e...
A: 8. ANSWER;- A reflective layer at the back of the eye that allows light to bounce around more, enhan...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: List and explain at least 3 Viral infections of the skin.
A: Skin is the outermost protective layer of our body. It can be caused by different microorganisms, ...
Q: Frog Human Dog -Lizard Duck Whale Duck and whale are close relatives. Frog is equally related to bot...
A: Phylogenic tree is a diagrammatic representation showing evolutionary relationships between organism...
Q: 1. The histones that form the tetrasome. 2. The histones added to the tetramer to form the oc...
A: Histones are proteins responsible for DNA packaging, they are positively charged and so can easily b...
Q: The offspring of the cross AA × aa are______ . a. all AA c. all Aa b. all aa d. half are AA and half...
A: The term Punnett square is associated with the table that plays an important role in describing the ...
Q: Which of these is a tetrapod that is NOT an amniote?
A: Tetrapoda is a Greek term that means "four legs. The Tetrapoda includes amphibians, reptiles (includ...
Q: in humans the condition for normal blood clotting dominates hemophilia these genes are x linked if a...
A: "ANSWER The sex chromosomes of the father are designated XY, with the X chromosome bearing the haem...
Q: Discuss the concept of termination of neurotransmitter action by comparing the mechanisms by which a...
A: * In a chemical synapse, the pre synaptic and post synaptic membranes are separated by a fluid fille...
Q: Do you think the scar would look better (i.e. the wound heal "better") if friend #2 underwent hyperb...
A: This is because the scars of Tb never heals, it cannot be reversed under any circumstances, even whe...
Q: The normal level of calcium in blood ranges from 8.5 to 10.2 mg/dL. It must be tightly controlled. M...
A: Hormones are biological compounds secreted by neurosecretory or endocrine glands that help to mainta...
Q: Which of the fat-soluble vitamins is needed for building bone, muscle contraction, and nerve impulse...
A: Introduction : Fat soluble vitamins are soluble in organic solvent or we can say that these are abs...
Q: how do you explain behavior using brain dynamics?
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are ...
Q: . A solute cannot move into a cell by crossing the phospholipid bilayer of the membrane. It can, how...
A: Answer The solute molecular are hydrophilic
Q: Complete Que Questions: 1. Why did Bell's patent hold up through time?
A: Conveying over large distances will be standard, dependable, joined into different activities and su...
Q: Refer to question 5. Assuming complete dominance, the F2 generation will show a phenotypic ratio of_...
A: Complete dominance: Diploid organisms frequently carry two alleles of a gene in the most extreme cir...
Q: Answer the following provided in the table. You may answer it briefly or by using a bullet. Charac...
A: Characteristics unique to seaweeds They have holdfast which help in attachment to hard surfaces th...
Q: Explain the mechanism of the forearm flexion and extension at the elbow joint together with the resp...
A: Forearm flexion is the rotation of the radius and ulna anteriorly in the anatomic plane. It occurs m...
Q: Independent assortment means .a. alleles at one locus assort into different gametesb. alleles at dif...
A: Introduction Sir Gregor Mendel is known as the Father of Genetics. He was the pioneer scientist who...
Q: Which of the following statements about E. coli is true? Some infections can be fatal to humans. It ...
A: Correct option A i.e some infection can be fatal to humans.
Q: 23. On the basis of shape, identify the type of microbes.
A: *In bacteria, the cell wall is a rigid structure with thickness around the cell and it is responsibl...
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- a cell defense worksheet (1) [Compatibility Mode] Qv Search in Document Insert Draw Design Layout References Mailings Review View Acrobat + Sha 三,三, Century Gothic , 12 A A- Aa A IU abe X, x² Styles Styles Pane Create and Share Reque Adobe PDF Signatu What does polar mean? Hydrophilic Step 8: Insert channel proteins into the membrane. Transport substances across the membrane. Note: You can only transport substances using channel proteins until there were What is this process called? Step 9: Moving from to concentration requires the use of energy to substances. This is called transport and uses: (place answer in table) 1. 2. Which is cell Step 10: Carbohydrates are like identification badges. Cells that have different membrane The immune system uses the carbohydrates to carbohydrates do different that your cells belong to and are not or other foreign cells. What does the immune system do to foreign invaders? 149% E Focus 目 Page 2 of 3 505 words English (United States) MAR 15 MacBook Air…Drag the labels onto the diagram to identify the anatomical terminology describing body orientation and direction (human a Posterior (caudal) Distal Superior (dorsal) Proximal Inferior (caudal) Anterior (ventral) Posterior (dorsal) Pearson archE Classwork for BTMF_Itani_ Biolo X E SI'ERRA STANLEY - protein-synth X arch 8 period light reaction - Google S x ocs.google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit LEY-protein-synthesis-worksheet_practice-converted ☺ Insert Format Tools Add-ons Help Last edit was 5 minutes ago 100% Normal text Noto Sans . BIUA 12 川, 三= + - I 1. 2 . 4. 5 PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the strand and ONLY start on AUG and STOP when it tells you to stop. Follow example below: Example: DNA O AGA CGG TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC mRNA O UCU GCC AUG GAG GCC ACC CÁC GAA CAG ACA UAG GAA GAG UCA UAG protein 0 start - glu – ala -thre - hist – asp -glu-threo-stop acid acid 1. DNA → CCT CTT TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC MRNA → protein → 2. DNA → AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA MRNA → protein → 围 Sign out Co & 6. 7
- esign Layout References Mailings Revicn A" Aa A AaBbCcDd AaBbCcDd AaBbCcDd AaBbC 00 A D.A- 1 Normal 1 Title 1 No Spac... Heading 1 Subtitle A Select Paragraph Styles Editing Voi you have the necessary permissions to upload the file. Save a Copy Chapter 9-1 What is the correct sequence for the three stages of cellular respiration? P. 222 What is released during cellular respiration that is not a chemical compound? P. 222 3. How many molecules of ATP are released from one molecule of glucose? P. 223 What is the correct balanced equation for cellular respiration? P. 222 What molecules are broken down during cellular respiration to release energy? Page 222 or 223 What are the reactants in the equation for cellular respiration? P. 222 What are the products of cellular respiration? P. 222 1. 2. 4. 5. 6. 7. 6c0 What stage of cellular respiration takes place in the cytoplasm of the cell? P. 222 What is the net gain of ATP from glycolysis? P. 223 10. What is the starting molecule for…molecules of actin could it hold? Assume the cell is spherical The Size of Cells and Their Components (a) If you were to magnify a cell 10,000-fold (typica] of u magnification achieved using an electron microscope), ho ples of Bioch 1. yotic cell with a cellular diameter of 50 µm. (b) If this cell were a muscle cell (myocyte), how many and no other cellular components are present; actin molecules are spherical, with a diameter of 3.6 nm. (The volume of a sphere is %ar.) (c) If this were a liver cell (hepatocyte) of the same dimensions, how many mitochondria could it hold? Assume the cell is spherical; no other cellular components are pre- sent; and the mitochondria are spherical, with a diameter of 1.5 µm. h (d) Glucose is the major energy-yielding nutrient for most cells. Assuming a cellular concentration of 1 mM (that is, 1 millimole/L), calculate how many molecules of glucose would be present in our hypothetical (and spherical) eukaryotic cell. (Avogadro's number, the number of…istration | Stud in Chrome - Lecture Final Port 2 (page 4 of 25) A tconline.texarkanacollege.edu/mod/quiz/attempt.php?attempt3D502922&cmid%335302&page%3D3 - TEXA COLL e Admis Question 4 e here: > Registration P Flag question Not yet answered Points out of 1.00 ent Solid Fat cration ng Select one: and Payment: O a. polysaccharide in plant cell walls, indigestible by humans se Schedule nofficial Transc O b. high surface tension, polar, universal solvent uation O c. Storage form of glucose in plants Form 1098-T ent ID's & Photo O d. Usually of animal origin, clogs arteries, butter ways & Connect O e. Storage form of glucose in animals ncial Aid rse Search ng 2022 Courses coming Term Cou uest Previous page 5 Interrupted Tes ick Links Time left 0:56:26 gation DELL C
- izzing/user/attempt/quiz_start_frame_auto.d21?ou=D3269550&isprv3&drc%3D1&qi=1995726&cfql=0&dnb3D0&fror 12 Time Left:0:04:09 Angelina Tran: Attempt 1 O anabolism Question 50 (2 points) Listen Which of the following is NOT part of the endomembrane system? O chloroplast plasma membrane vesicles endoplasmic reticulum Previous Page Next Page Page 10 of 10 Submit Quiz 45 of 50 questions saved MacBook PrOA Classwork for BTMF_Itani_ Biolo x A S'ERRA STANLEY -protein-synth X O 8 period light reaction - Google S x google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit - protein-synthesis-worksheet_practice-converted O sert Format Tools Add-ons Help TUR Last edit was 10 minutes ago 0% Normal text Noto Sans BIUA 川。 三E▼=、三三 13 + 田回▼ 1 3 4. 5 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC mRNA → protein > Son out Co 4. 6. 8. 9.Safari File Edit View History Bookmarks Window Help 100% 4 Thu 7:57 AM Molly Foy A numerade.com O Meet Lab Quiz 3(C... My Question... An artificial "... (1) Choose y.. Choose your... HONORS/U... DRAW IT An... CP Algebra II... Google Trans... Enregistrez A meet.go PROBLEM 6 Chapter 7 Membrane Structure and DRAW IT An artificial "cell" consisting of an aqueous solution enclosed in a selectively permeable membrane is immersed in a beaker containing a different solution, the "environment," as shown in the accompanying diagram. The membrane is permeable to water and to the simple sugars glucose and fructose but impermeable to the disaccharide sucrose. Function BIOLOGY Campbell Biology (a) Draw solid arrows to indicate the net movement of solutes into and/or out of the cell. (b) Is the solution outside the cell isotonic, hypotonic, or hypertonic? (c) Draw a dashed arrow to show the net osmosis, if any. (d) Will the artifi- cial cell become more flaccid, more turgid, or stay the same? (e)…
- light reaction - Google: Jod. google.com/document/d/1plhyciPrM-AMsQKmaUHZSZU44EJL85jDuCyDxE01E60/edit NLEY-protein-synthesis-worksheet_practice-converted @ w Insert Format Tools Add-ons Help Last edit was 7 minutes ago 100% - Normal text Noto Sans . BIUA 12 川, 三三▼ 3 5 Y 6. 7 I 3. DNA → TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC MRNA → protein → 4. DNA → TAA ACT CGG TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA → protein → 5. DNA - CTA TTA CGA TAC TAG AGC GAA TAG AAA CTT ATC ATC MRNA → protein → Sign out 围 Ce & 6. 8. 3. de 5Give typed explanation not a single word hand written otherwise leave it Need help on 1 question (two part question) 1) A) Add a phosphate molecule onto adenosine. What kind of reaction was performed? What kind of bond is formed? What is the name of this molecule? Draw the structure on paper. B) How would you modify this molecule to make ATP? Draw the structure of ATP. Thank you!BCMB 205 (General Biochemistry) Department of Biochemistry, Cell and Molecular BiologyFirst Semester 2020/2021 Interim Assessment1. Briefly discuss five (5) importances of Biochemistry in Agricultural Science2. Using the table below, indicate wether the listed structural components are present (+)or absent (-) in prokaryotes and eukaryotesCell structureGolgi apparatus Plasma membrane Cytoskeleton Mitochondrion Nucleolus ChloroplastCell wallNucleusRibosomeSmooth endoplasmic reticulumProkaryotes (bacteria)Eukaryotes (plants)3. State the biomolecular composition and function of the following cell components: Plasma membrane, Rough endoplasmic reticulum, Cell wall, Mitochondria, Chloroplast.4. Briefly distinguish between the following terms with appropriate examples:a. Epimers and diastereomersb. Aldoses and ketosesc. Alpha (α) anomer and beta (β) anomerd. D glucose and L glucosee. Pyranose and furanose5. Provide the structures and functions of three biochemically important…