How long would the peptide be that is translated from this mRNA sequence: AUGGGCUACCGA ? Group of answer choices 12 6 3 4 cannot tell from what is provided here
Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?
A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…
Q: Why does menstruation occur?
A: Introduction In human females, they have a menstrual cycle which is a cyclical change that occurs…
Q: What is Wilms tumor and what cellular components are involved?
A: A mass of tissue that develops abnormally when cells do not die on schedule or expand and divide…
Q: give example for food record/diary of weighed quantities of food consumed by an individual for 4 day
A: Weighed food diaries, often known as diet diaries or food records, are prospective dietary…
Q: When do sex hormones first exhibit an effect on sexual development?
A: Sexual development refers to the changes that occur in the body as we progress from puberty through…
Q: Allied Corp.. a food processing company, wants to achieve competitive advantage by sustainable…
A: An ecosystem is essential because it conveys one of the key insights we have gained from ecology…
Q: Edge effectsa. result from species crowding at edge of habitats.b. mean that no plants can grow well…
A: When two different types of habitat collide, a phenomenon known as the edge effect occurs. At the…
Q: 4. Tabulate the similarities and differences between an acidic and basic buffer solutions
A: When a little amount of acid or base is diluted or added, the buffer solution undergoes only slight…
Q: 2. Compare and contrast inductive method and deductive method. Which method do you think is…
A: Introduction The main difference between inductive and deductive approaches to deal with research is…
Q: The study of tissues is called cytology
A: Tissue is defined as group of cells that possess a similar structure and perform a specific…
Q: Please draw a concept map using the following terms for regulation Repressor, Inducer, Induction,…
A: An enzyme, such as peroxidase found in bacteria, can be used to illustrate how a gene's expression…
Q: 5. Identify and briefly describe other conditions that would cause a red eye. 6. What warning signs,…
A: The body has multiple parts and organs that have their specific structure and function that help the…
Q: Which of the following must be available in sufficient supply for glycolysis to proceed? a.…
A: Introduction Glycolysis is the process where glucose is broken down to form pyruvate and energy.…
Q: estion 1. a) Draw and discuss e components, location, energy anges, what reducing equivalents e…
A: in glycolysis a molecule of glucose is degraded in a series of enzyme catalyzed reactions to yield 2…
Q: Answer the following questions from 1-5
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Complete the chart below to indicate which occurrences would provide barriers sufficient for…
A: Introduction Speciation:- The speciation is the process of the formation of new and different…
Q: CD4 is O The receptor protein on some immune cells that allows HIV to recognize its host cell The…
A: AIDS is most severe form of HIV infection.The transmission of HIV requires contact with a body fluid…
Q: Harry Potter speaks parseltongue (he can talk to snakes). Dumbledore explains that this is because…
A: Introduction Gene is the basic structural and functional unit of heredity. Gene controls all the…
Q: Tommy is albino and has children with Ruth who is not albino, but has an albino mother. What…
A: First question: Let the alleles of albinism be - A and a. Since albinism is inherited in recessive…
Q: Explain how and why membrane potential changes during anaction potential
A: Introduction The nerve helps in the transmission of signals from CNS (Central Nervous System) to the…
Q: Are the Sweet potato and Potato homologous or analogous? What type of evolution has brought such a…
A: Introduction : In biology, evolution is the alteration in a species' traits over a number of…
Q: Bacteria are _in comparison to eukaryotic cells.
A: Introduction The cells are the fundamental units of all living things. There are billions of cells…
Q: Which of these is a true statement?a. Habitat loss is the most frequent cause of extinctions…
A: Introduction Biodiversity is the different species of plants, animals and microorganisms present in…
Q: Explain the following areas about (Types of laboratory devices) 1. Who makes up the device or what…
A: Types of Laboratory device Device - Light Microscope 1. Who makes up the device or what are the…
Q: To దరరంహం సంద ఈ (A) The blue trait is inherited as an autosomal recessive trait which means that…
A: The pedigree analysis helps us to understand the inheritance of a particular disease by observing…
Q: For the following problem: Identify the gametes for each parent, build a Punnett Square of the…
A: Brown fur (B) is dominated over the gray fur (b). Cross occurs between the homozygous dominant mouse…
Q: Name the four essential elements in cell communication.
A: Introduction Cell signaling is the process in which different cells in the body of an organism…
Q: aerobic better for steady state and anaerobic better for burst
A:
Q: Adaptation and change in populations involves the interplay of many factors. Below is a list of some…
A: Introduction Adaptation is needed for living organisms to survive, An adaptation is a…
Q: Fast fast fast
A: Introduction The cells are so minute structures that we cannot see them with unaided eyes, we…
Q: Provide the common name for the region to whicheach of the following terms refers:a. Acromial b.…
A: In above quetion some of anatomical adjective is given and ask about there common name. Anatomical…
Q: Please answer fast using the 7 characteristics listed , identify two things that always have all…
A: Living things The things which can move, grow, reproduce, have cell etc are considered as living…
Q: How do the activities of exercising, voluntary hyperventilation, and breathing into a bag for a few…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: When and where did Homo sapiens originate? Evaluate which hypothesis better supports the current…
A: Evolution of modern humans i.e. Homo sapiens is explained by various hypothesis such as multi…
Q: Determine the site of the occurrence of mutation in the promote that prevents the binding of RNA…
A: The key component of the operon's promoter region is an RNA polymerase binding site that serves as…
Q: Define biology
A: Science is the study of nature, the way natural things behave, and how they actually work in the…
Q: Do blind people dream in visual images?
A:
Q: Explain the following areas about (X-ray machines) 1. What are the ingredients the device? 2.…
A: The development of CT and the discovery of X-rays both marked significant developments in medicine.…
Q: 14. During an experiment, type II pneumocytes are found to produce a phospholipid-protein mixture…
A: Introduction:- The alveoli forms the lower part of the respiratory tract and helps in the exchange…
Q: Compare renewable versus nonrenewable resources.
A: Introduction Ecological Footprint (EF) represents the demand of a person or a group of a person on…
Q: What are the three phases of hepatitis viral infection?
A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: In this question, Hardy Weinberg equilibrium will be applied which is also known as the Hardy…
Q: What role does biodiversity play in the energy flow of ecosystems?
A: Ecosystems sustain themselves by recycling nutrients and energy from outside sources, such as the…
Q: QUESTIONS TO ANSWER: 1. Basic Microscopy 1. State 3 ways to handle the microscope properly.
A: Microscopy:- it is a technique used to magnify or enlarge the images of very small size objects such…
Q: Explain the following areas about scan)) ((Computed tomography..CT 1. What are the ingredients the…
A: A computed tomography scan is a type of medical imaging procedure used to produce in-depth pictures…
Q: The image above was taken using a 40x objective lens in our MoCell lab with 2.5 calibration factor.…
A: A microscope is an instrument that can be used to observe the small objects like, cells. The image…
Q: Explain how cells respond to external signals, even when those signals cannot enter the cell.
A: Introduction Cell signaling is the process in which different cells in the body of an organism…
Q: Describe the settings in which the reversed process of proliferation and differentiation is…
A: Cell proliferation can be described as a process of exponential growth and division of cells for…
Q: Evaluate how paleo anthropologist are able to reconstruct diet, locomotion, and behavior about once…
A: Modern humans have a superior survivability, live longer, begin reproducing later, and have smaller…
Q: List three major steps that are hypothesized to have occurred in the evolutionary history of…
A: Photosynthesis occurs in plants and some green algae. This occurs due to the presence of chlorophyll…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
- Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterBelow is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.The amino acid sequence of human vasopressin is Cys-Tyr-Phe-Gln-Asn-Cys-Pro-Arg-Gly. Write an mRNA sequence that would encode this oligopeptide (tiny protein). Label the 5' and 3' ends of the mRNA.
- The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedThe coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.Give only typing answer with explanation and conclusion The Shine-Dalgarno sequence (or Shine-Dalgarno box), is a conserved sequence in the mRNA, generally located 8 base pairs upstream of the start codon AUG. The complementary sequence (CCUCCU), is called the anti- Shine-Dalgarno sequence and is located in another cellular nucleic acid. Which one? The antisense strand of DNA of the translated gene The 23S rRNA The fMet-tRNA The 5S rRNA The 16S rRNA
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GPolycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key differences in mRNA structure and subsequent translation that support this observation. Answer in 250 words and cover all parts.This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.