Q: DIRECTIONS: Examine the illustrations of the marine organisms shown below whose fossils make up part…
A: * Darwin said that the Fossils records provide evidence that the living organisms evolved from many…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: Our body' structure is provided by bones. There are 206 bones in the mature human skeleton. The…
Q: What is special about the coloring of most tinamou eggs? 2. What ability do tinamous have that…
A: 1. The colour of the tinamou's eggs is due to the interplay between pigment coloration and what is…
Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…
A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…
Q: Like nucleotides, amino acids have directionality in their back bone. While nucleic acids are…
A: Central dogma The process of translation of DNA into gene products is called the central dogma. It…
Q: Identify the stages of mitotic division observed in one of SimpLENI's slides labeled as A, B, and C.…
A: The stage labeled as A is Telophase. Telophase is the 4th stage of mitosis where the sister…
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: Hypocomplementaemia is the disease of the immune system in which the amount of the complement…
Q: Task 2 Week 15 4. FIGURE 4 shows sugar transport in phloem. Phloem A В 888 Source cell $8888 Sink…
A: Introduction The movement of materials across cell membranes is referred to as cell transport.…
Q: Q4.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion…
A:
Q: What is psedupodia
A: Introduction :- A pseudopodium is a transient protrusion of a eukaryotic cell's cytoplasm.
Q: se trhe imlage to arISwer the Posterior pituitary releases oxytocin Baby suckles Oxytocin stimulates…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: true or false: meiosis takes place in body cells called somatic cells.
A: Meiosis is a double division which occurs in a diploid cell and gives rise to four haploid cells…
Q: Question 37 During bacterial RNA chain elongation, proceeds ahead of the transcription bubble…
A: The process by which RNA molecules are synthesized on a DNA template is called transcription.…
Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…
A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…
Q: Which of the following brain structures helps a person recall things by waking up the areas of the…
A: The brain helps in the controlling of the body so it is known as the control centre of the body. All…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: * Skeleton is the framework of human body which is composed of 270 bones at birth and can be…
Q: Spongy bones do not have a haversian system. a) False b) True
A: Introduction - Compact bone is more dense and lighter than spongy (cancellous) bone. Plates…
Q: humectants as food additives.
A: Food additives Food additives are substances that when added to food increase their flavours, taste,…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: What two items are needed to open a cell and release the DNA and then open the strands?
A: DNA is the basic unit of inheritance. There are many cytological and molecular biology techniques to…
Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…
A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…
Q: Anaerobic respiration in humans occurs primarily in muscle cells during high- intensity exercise.…
A: Primary source of fuel in muscles is glucose, for both aerobic and anaerobic metabolism. In aerobic…
Q: Narcolepsy is thought to occur from dysfunction of neurons located in the hypothalamus hippocampus…
A: Introduction - Narcolepsy is a persistent sleep condition marked by excessive daytime sleepiness and…
Q: In prokaryotes, the sigma factor recognizes base sequences in the . which facilitates RNA polymerase…
A: The major step of initiation of RNA synthesis is the facilitation of RNA polymerase binding. This is…
Q: Organisms growing anaerobically cannot perform glycolysis for long without reducing the pyruvate…
A:
Q: explain what is similar and what is different from the bacteriophages of covid-19
A: Bacteriophages or phages are the viruses that infect and kill bacteria. Bacteriophages consist of a…
Q: What is the outgroup between deep sea Dragon and shiny loose jaw And 2 similarities and differences…
A: Cladistics or phylogenetics is the maximum usually used technique in the biological category. It…
Q: What is the root cause of internal splintering?
A: A splinter hemorrhage causes a person to have longitudinal streaks down the nails, which typically…
Q: Question 1: You suspect that a patient has sepsis. A. What type of specimen would you collect to…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…
A: The double standard DNA molecule is produced by the action of DNA volume range and the process…
Q: List two possible missense mutation effects on the new polypeptide.
A: *missense mutation occurs when there is change in a single base pair that causes substitution of…
Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…
A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…
Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…
A: Transcription is the first step in the gene expression which transfers the genetic information…
Q: According to the recent malaria report of the Department of Health, Disease and Prevention Bureau…
A: The malarial parasite passes its life cycle I'm two different host's. The man is the intermediate…
Q: 1. Please describe the behavior of cranes. 2. How do peregrine falcons see the world?
A: Behaviour of Cranes.. #The cranes are diurnal birds that vary in their sociality by season and…
Q: Question 19 A transversion mutation would be replacing T by: (A) either A or G BU
A: Ans- In molecular genetics, transversion refers to as the point mutation in which purines are…
Q: Stainable living strategies for people living in the Savanna Desert in Amboseli National Park…
A: Sustainable strategies are those strategies which are plant in a way to protect the environment not…
Q: Recent - English (en) - 23/4/2022 l a 12:00 e ial الاجابة تكون على شكل نص كتابي فقط و يمنع تحميل…
A: A BUN test is a blood test most commonly used to evaluate kidney function. It's often done along…
Q: Question 4 In order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or…
A: The replication process is responsible for producing the ds daughter DNA molecule from parental ds…
Q: Explain why dichloromethane is a good solvent to remove the fat from the milk? Can you use organic…
A: Dichloromethane is a good option for milk fat removal. The reason is: Dichloromethane is a polar and…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…
Q: The elements that present in Protoplasm
A: A cell's protoplasm, cytoplasm, and nucleus are all examples of protoplasm. The phrase was first…
Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…
A: Rheumatic fever:A illness that can develop as a result of strep throat or scarlet fever that has…
Q: Which of the following does NOT tend to promote genetic divergence between populations? a)…
A: The genetic diversity has three different sources: mutation, recombination and immigration of genes.
Q: The distribution of a herd of deer is shown in Fig. 4.17. Using the values below for the dimensions…
A: Introduction A population is a group of individuals of the same species living in the same region…
Q: Summarize the passage “Walking and fat loss”., and describe the reasons why walking is not effective…
A: Walking is a shape of a low effect, moderate-intensity workout that has various health blessings and…
Q: Lidocaine is an anesthetic that is used to prevent the propagation of action potentials. Which…
A: The neurons are the nerve impulse generating and transmitting cells in our nervous system that have…
Q: HITCHHIKER'S THUMB: The distal (last) joint of the thumb can be bent back to form a 45 degree angle…
A: Hitchhiker thumb is encoded by gene present on autosomal chromosome. It is a recessive trait.
Q: Answer questions in the table below about the shape of the hydrogen cyanide (HCN) molecule. How many…
A: The structure of the HCN is linear as the central atom is carbon .
Q: Question 5 Which of the following distinguishes a DNA from an RNA? O Presence of a GC base pair in…
A: Uracil helps in many synthesis by acting as a allosteric regulator and co enzyme in many synthetic…
how does a high complexity habitat influence predator and prey interaction please explain in own words
Please answer asap and type your answer and do not copy from anywhere please answer asap
Step by step
Solved in 2 steps
- SUBJECT : Biology - Ecology Give 5 examples each of dominant, invasive, and keystone species in a tabulated format AND explain how dominant, invasive and keystone species affect their community.Expat Med @DrExpat_ 4. Respond to this tweet on the right using mathematical evidence from the Lotka-Volterra model of predator-prey interactions. Draw a graph to illustrate what the Roomba's population growth rate would look like in the wild in the absence of predation (*assuming the Roomba was capable of reproduction in its new habitat). I LEFT MY FRONT DOOR OPEN AND MY ROOMBA JUST WENT OUT AND I CAN'T FIND IT. WHAT ARE THE CONSEQUENCES OF e THIS. IT HAS NO NATURAL PREDATORS. 3:50 AM 19 Dec 18 Twitter Web Client a th 1,755 Retweets 8,619 Likes 5. Are there any factors missing in the Lotka-Volterra model of predator-prey interactions that you might need to include to accurately model prey population growth in the absence of predators? ar at eePrepare a written answer of between 300-350 words. To inform your written answer you should consult any resources you want in books or magazines at your disposal and especially any on-line resources.The trophic pyramid has very few large predators at the top and increasing numbers of creatures as you go to lower levels of the food chain. Why is that? If there are lots of prey animals in a system why aren’t there just as many predators?
- Define the following terms: Predator Prey PopulationAfter completing the GVL OER module - Population Dynamics, explain the relationship between predator and prey. Identify the patterns that exist in the dynamic relationships between predator and prey. Relate your discussion to the overall health of their populations and ultimately the ecosystem. How does each organism benefit from the other? In what ways do other populations in the ecosystem benefit?can you describe what is going on this pictures. think of any possible ecological interaction as you can.
- How is the topic about Threats (Biodiversity & Sustainability, Climate Change and Pollution) and Conservation and Protection interesting and/or the most impactful for you? Write a short essay (300-500 words) explaining why or how you think it has provided an influence or inspiration to you as a biology student.Uhtps/fufuture.uitm.edu.my B Which of the following is no Which of these resources is the X New coursehero.com/tutors-problems/Ecology/21473714-Which-of-these-resources-is-the-least-likely-to-generate-competition-b/ © WhatsApp Course Hero A CSC PROJECT - Go. Homework Help -- purse Hero Find study resources Question Get Answer 8. Which of these resources is the least likely to generate competition between two different species living in the same area? A. Mates B. Space C. Minerals D. Food E. Sunlight Uploaded by: Zoobuddy Subject: Biology, Peology, Science Report Get Answer acer F4 F5 F6 F7 F8 F9 F10 F11 F2 F3 2021/2/23 09:04 DIB O- 64Read the paragraph and look at the chart. Then answer the items. 1% 26% Over 30% of the world's frogs and toads have an official 29% status of “threatened" or “near threatened." Much of this is 6% due to capturing frogs and toads for the pet trade, as well as systematic deforestation of their habitats. The oophaga lehmanni, also known as the Lehmann's poison frog or red-banded poison frog, is critically endangered, for example. Its distribution, throughout areas in its native Columbia, is 39% Frogs Extinct 1% Near-threatened 29% scattered and continues to decline. Least Concern 39% Data deficient 28% 1. What information does the pie chart provide? 2. How does the key below the pie chart help you to better understand the pie chart? 3. How does the pie chart support what the text states? 4. Write one fact you learned from the pie chart or the text.
- Which statement is false regarding this pie chart? Question 13 options: Dogs are more popular than cats and hamsters combined Fish are more popular than any other pet 5% of the pie graph is taken up by other pets Cats are more popular than hamster and other pets combinedhttps://www.salon.com/2022/02/08/us-flood-risk-is-about-to-explode--but-not-for-the-reasons-you-think_partner/ Did the author support his/her/their thesis with evidence? Do you agree/disagree with the author’s position? Why or Why not? What did you learn from this article? What connections can you make to this Environmental Sociology course?Summarize; From my observation post, well camouflaged under some boxwood bushes, I delight in the contemplation of dinco young foxes that play at the door of their refuge. They have come out half an hour ago, with all caution, when the sun was peeking over the peaks. Little by little they have gained confidence; lying in the most comical postures they have been nibbling, only to end up chasing each other openly over the fresh grass that grows before the black hole of the cave. Suddenly the five foxes at the same time rush towards their fort. Almost at the same moment I smell a growing buzzing behind my head, like that produced by a flock of pigeons flying low through an oak grove. First I see a huge shadow, exactly in front of the peephole of my observatory. A brown mass is mistaken for it. It is the royal eagle. With the wings semi-closed, forming an angle with the body, with the claws open and advanced, the bird of Jupiter is materially nailed against the wall of the fox…