As you continue the translation process you will reach to the stop Codon.The stop codon brings in the release factor (a protein) that will cleave the polypeptide attached to the tRNA at the "P" site and that terminates translation:GluTrplleLargeRibosomalSubunitCysHisSmallRibosomalSubunitTranslation of RNA into ProteinsELIRNARibosomeStop5HDAQN ALM.RNAAmino AcLargeRibosomalSubunitGo ahead and repeat the translation process but for Transcription translation Sequence II.Once you have formed the polypeptide from Sequence II select which amino acid is in the C-terminus.ProSmallRibosomalSubunitTranslation of RNA into ProteinsEERNA6644955-56-StopRibosome

The process of producing proteins from an mRNA template is referred to as translation. Ribosomes…

Go ahead and repeat the translation process but for Transcription translation Sequence II. Once you have formed the polypeptide from Sequence II select which amino acid is in the C-terminus Pro Glu Trp lle Cys His

Go ahead and repeat the translation process but for Transcription translation Sequence II. Once you have formed the polypeptide from Sequence II select which amino acid is in the C-terminus Pro Glu Trp lle Cys His

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: The symbols A, B, C, D, E represent all the components of the lac operon, excluding LacA. The…

A: The lac operon regulates gene expression in lactose metabolism in E. coli. It is composed of a…

Q: If you discovered a new type of nucleated cell in a lake near your home,how would you determine…

A: Discovering a new type of nucleated cell in a lake near your home is an exciting scientific finding.…

Q: Which of the following would be expected to inhibit PKC activation by a GPCR ligand?…

A: Protein kinase C (PKC) constitutes a family of enzymes intricately involved in diverse cellular…

Q: Name the structure. a. НО. H3C OH N NH

A: A molecule is the smallest particle of a substance that retains the properties of that substance. It…

Q: Calculate the BMI of a woman who is 1.65 m tall and 61 kg in weight

A: BMI ( Body Mass Index) is a measure of body fat by using the body weight (in kilograms or pounds)…

Q: 2. Rotenone: inhibits NADH dehydrogenase (complex I). NADH levels: H* Gradient: Reduction of O2: ATP…

A: Cellular respiration is the process through which breakdown of organic compounds like glucose takes…

Q: a researcher studying two species (species 1 and species 2) sequences a short stretch of eight…

A: The question includes comparing the sequences of the same gene from two diverse species that had a…

Q: The immune system can be split into two major categories, the innate immune system and the adaptive…

A: To protect the body from dangerous invaders like bacteria, viruses, fungi, and parasites, the immune…

Q: A baby born with ovaries will already have all of the eggs cells their body will ever make.…

A: The ovaries are two little organs situated in the female pelvis that are around the size of a human…

Q: name the organ on the fetal pig brain

A: Fetal pigs are the unborn piglets killed by industries for the production of meat. Generally, pigs…

Q: For each of the following scenarios: 1. State the division of the ANS that is represented 2. Draw in…

A: As the question contains multiple snapshots, as per our expertise regulations only first three…

Q: A patient with H. pylori infection develops a gastric ulcer and is treated with omeprazole. Which of…

A: The correct answer is option D. Inhibition of H+-K+ ATPase. Omеprazolе primarily еxеrts its…

Q: What is one of the components of a sustainability revolution? a. consume and throw away…

A: The objective of the question is to identify one of the components of a sustainability revolution…

Q: Which of the following animals demonstrate embryonic diapause? --whale --human --pig --platypus…

A: Embryonic diapause is a fascinating biological phenomenon watched in an assortment of creature…

Q: A. What is the probability that the allele reaches fixation in humans? Assume it is a new mutation…

A: The probability (P) that a new mutation with frequency 1/(2N) reaches fixation can be calculated…

Q: draw the chemical structure of a strand of dna with the sequence ATG.

A: A polymer known as deoxyribonucleic acid is made up of two polynucleotide chains that twist around…

Q: 10000 bp 8000 bp | 6000 bp 5000 bp 4000 bp | 3500 bp 3000 bp 2500 bp 2000 bp 1500 bp 1000 bp 750 bp…

A: Agarose gel electrophoresis is a molecular biology technique used in laboratory to detect the…

Q: Mina is a 35-year-old woman in a monogamous, long-term relationship. She and her partner have just…

A: Contraception, additionally referred to as birth control, describes the methods and technologies…

Q: What is a membrane histocompatibility complex? Contrast MHC I and MHC II.

A: The genes that code for cell surface proteins that aid the immune system in differentiating between…

Q: Bypass reaction in the anabolic pathway often occurs when A The ΔG of the reverse reaction in…

A: Delta G represents the free energy change. This value is indicative of whether the reaction will…

Q: To what class does this animal belong?

A: Mammals are warm-blooded vertebrates that nourish their young with milk produced by mammary glands.…

Q: Limbic System, Emotion, Reward, and Addiction Describe the role of the amygdala in emotion at the…

A: The Papez circuit, also known as the limbic circuit, is a neural pathway in the brain that was…

Q: For predators that devour their prey, how does their digestive tract function to digest the food

A: A fascinating feature of the physiology of predators that consume their prey is their intricately…

Q: The 6th and 7th women Nobel Prize winners in Chemistry, Professors Jennifer Doudna and Emmanuelle…

A: The genome is a cell's whole collection of DNA blueprints. The genome of human beings is made up of…

Q: What are the differences between yeast, mold, and mushroom?

A: Yeast, mold, and mushrooms are all fungi, but they display distinct characteristics and play…

Q: 7. In a study of a Native tribe in North America, researchers found 26 albino individuals in a…

A: This topic is about understanding populace genetics standards, particularly the Hardy-Weinberg…

Q: What is prevention in healthcare?

A: Prevention in healthcare refers to measures taken to prevent diseases rather than curing them or…

Q: Which of the following represents bi-substrate mode of enzyme substrate binding? O Lock-and-Key…

A: Enzyme-substrate binding is an important step in enzymatic processes.The Lock-and-Key paradigm…

Q: The following diagram shows a short piece of a protein. Use the diagram to answer the following…

A: Proteins are made up of amino acids. These amino acids are connected together by peptide bonds to…

Q: Which of the following bones is found in the nasal cavity of mammals such as pigs? --sclerotic ring…

A: The nasal cavity is a complex structure within the head that plays a crucial role in the respiratory…

Q: Use the following figure to answer the question. Shaded crossed symbols indicate affected…

A: Tay Sachs disease has an autosomal recessive inheritance. It might not be seen for some generations.…

Q: Introduction to Neuroscience College Level). Describe the synaptic and molecular mechanisms of…

A: A cellular mechanism for learning and memory, long-term potentiation (LTP) is the steady…

Q: Compare and contrast oncogenes and tumor suppressors. Contrast oncogenes and proto-oncogenes.…

A: Genetic changes are the primary cause of cancer, an incredibly complicated and multidimensional…

Q: Follow the changes in POTENTIAL ENERGY in these five processes in central metabolism (#) number of…

A: Glycolysis is a fundamental or universal metabolic pathway occurring in the cytoplasm of cells. It…

Q: For this pedigree, assume all individuals are homoplasmic, but people from different families have…

A: Mitochondrial DNA (mt DNA) is a circular chromosome found inside mitochondria. Unlike nuclear DNA,…

Q: Bacterial have a special amino acid that begins many of their proteins. It is recognized by the:…

A: In bacteria most of the amino acids are in D form. They join with each other via peptide bonds to…

Q: 3. Fill in this summary table to compare and contrast types of transport. For secondary, first you…

A: All living cells must receive nutrition, water, electrolytes, etc. that must enter the cell. At the…

Q: To what subclass does this animal belong? Theria Metatheria Protheria Mammalia Ornitheria

A: Q.Ans:-Explanation: The given image is of a Duck-billed Platypus. The duck-billed platypus is an…

Q: Limbic System, Emotion, Reward, and Addiction Describe the papez circuit at the introduction level…

A: The Papez circuit, also known as the limbic circuit, is a neural pathway in the brain that was…

Q: predators that devour their prey, how does their digestive tract function to digest the food?…

A: Prеdators with a carnivorous diеt typically havе spеcializеd digеstivе systеms dеsignеd for…

Q: To what genus do pigs belong? --Homo --Pisaster --Sus --Suidae --Pan

A: A genus is a taxonomic rank below the family and above the species. It is used to group species…

Q: What is the probability VII-2 be a carrier? A) 1/4 B) C) D) 1/3 E) 2/3 F) 1

A: The pedigree indicates a recessive disease since it follows the pattern of occurring rarely unless…

Q: You are interested in the expression of regions of the X chromosome at different times in human…

A: The investigation of the X chromosome at different phases of human fetal development is a complex…

Q: Based on the BLASTp and Reciprocal hit analysis is mus musculus a true ortholog for the human fgfr3…

A: Ortholog genes are those genes which are present in different species but have a common ancestor.…

Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA

A: Gene expression is the procedure through which data from a gene is employed in the production of a…

Q: Class switching is initiated by T-cell activation via CD40 ligation. You are working with a mouse…

A: Class switching, also known as isotype switching, is a process in B cells that involves changing the…

Q: If the other three forces that determine fluid movement were unchanged, an increase in blood…

A: The objective of the question is to understand the effect of an increase in blood hydrostatic…

Q: If this was a prokaryote where in the cell would this image be from?

A: Protein synthesis is a biological process that allows individual cells to build specific proteins.…

Q: let's say we've just found a single celled organism living in a pond. This organism has a nucleus, a…

A: Single celled organisms are made up of only one cell and cannot be seen through naked eyes. Such…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

As you continue the translation process you will reach to the stop Codon.
The stop codon brings in the release factor (a protein) that will cleave the polypeptide attached to the tRNA at the "P" site and that terminates translation:
Glu
Trp
lle
Large
Ribosomal
Subunit
Cys
His
Small
Ribosomal
Subunit
Translation of RNA into Proteins
E
L
IRNA
Ribosome
Stop
5
H
DAQN ALM.
RNA
Amino Ac
Large
Ribosomal
Subunit
Go ahead and repeat the translation process but for Transcription translation Sequence II.
Once you have formed the polypeptide from Sequence II select which amino acid is in the C-terminus.
Pro
Small
Ribosomal
Subunit
Translation of RNA into Proteins
E
ERNA
6644955-56-
Stop
Ribosome

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction :-

VIEW

Step 2: Explaining the concept

VIEW

Step 3: Explaining the concept

VIEW

Step 4: Explaining the concept

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
The mRNA codon of valine is GUC UGG CCA TTG
w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.
If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transition