Find the output of the given code if it is compiled on a 64-bit system. #include int main() { char *ptrToChar; int *ptrToInt; float *ptrToFloat; printf("%ld ", sizeof(ptrToChar)); printf("%ld ", sizeof(ptrToInt)); printf("%ld ", sizeof(ptrToFloat)); return 0; }
Q: If there are page faults 99 percent of the time, then that means they happen a lot (that is, a page ...
A: Management of Virtual Memory (Cache): TLB is an acronym for Translation Lookaside Table. It is a kin...
Q: : a. [(a mod n) - (b mod n)] mod n = (a - b) mod n
A:
Q: The computer was invented by John von Neumann in what year?
A: John von Neumann (John von Neumann): John von Neumann was a mathematician and chemical engineer born...
Q: Help me do the code by follow the descriptions. Import Java Scanner class
A:
Q: What's the difference between Stored Procedures and Scripts? What is the purpose of each? How does e...
A: Introduction: A stored procedure (also known as a proc, storp, sproc, StoPro, StoredProc, StoreProc,...
Q: s a) Hoore to Healy Con hest the b) Medly to Moome
A:
Q: Write an algorithm and draw a flow chart to check if person is vaccinated or not. If booster dose va...
A: step1: N = input("Have you Vaccinated(Booster does) :Enter Yes/No:") //reading input from user step...
Q: What is the origin of the Colossus machine?
A: The Colossus computers were created by British codebreakers between 1943 and 1945 to aid in the cryp...
Q: (c++)write a program to insert node at specified number in single linked list? (c++)write a program...
A: “Since you have asked multiple questions, we will solve the first question for you. If you wa...
Q: This is ML. Need help with code through SOML. And working with java (6p) Function max3 of type int i...
A: CODE:- The largest of three integers. public class LargestNumberExample3 { public static void main...
Q: Define the characteristics that are required for test-driven development. In the event that you wish...
A: TEST- DRIVEN DEVELOPMENT(TDD): In the software modelTest-Driven Development(TDD)...
Q: What is the ARM statement which correspond to the each following statement and find the value of R0?
A: The answer is
Q: In what way does multicore architecture differ from other architectures?
A: There can be many types of architectures like multicore architecture, multi processor architecture, ...
Q: format has micro operation field which is divided into 2 subfields F1 and F2, each having 15 distinc...
A: Here we explain it and write the size of micro instruction: ========================================...
Q: Create a c++ langauge that ask the user to enter a name (one word only) and then print the name in t...
A: Code: #include <iostream>#include <bits/stdc++.h>using namespace std; int main(){ str...
Q: 10). In interrupts the starting address is fixed. A. External interrupt B. Vectored interrupts C. No...
A: Correct answer is B) Vector Interrupts
Q: I need help putting a space in between my output I’m trying to find out what the problem is I am cur...
A: code :
Q: how to use break and continuous in conversion of string into a list in python for example "aababba"...
A: Python Code for the given question def _print(string): print(string[0], end = "") for i in range(1,...
Q: 2. Consider the system to be 64 bit, answer the following question in accordance to C language, i) ...
A: To find the size of int, char, int *, and char *, consider the system to be 64-bit and in accordance...
Q: 3 6. Evaluate the determinant for the following matrix: O A.8 O B.-2 O C.5 O D.-4
A: INTRODUCTION: We need to find the determinant of the matrix.
Q: Make a class named 'MyStringTest! Put it in a package named 'stringtester' and have it contain a mai...
A: Please Upvote/like me. Please. I need it badly. Please. First of all there are no inbuilt classes ...
Q: What is the definition of an integrated circuit?
A: Your question is about IC which is given below :
Q: Given 4 input variables: A, B, C and D. Find out the algebraic expressions of the following minterms...
A: Here, I have to provide a solution to the above question.
Q: 2. Write a JAVA program to find the sum of all elements greater than 50 in the array given belo int ...
A: code
Q: A micro instruction format has micro operation field which is divided into 2 subfields F1 and F2, ea...
A: Introduction: In logic, if there are n micro-operations, we may describe them as 2n, where n is the ...
Q: ], int n, int key) that will search key in array A. If it is in the list, the function should return...
A: The c++ program is an given below : #include <iostream>using namespace std; int search(int a...
Q: eginning work on this discussion forum, review the Web Programming, Advanced JavaScript reading and ...
A: Lets see the solution.
Q: Make a class 'StringMethods! It contains a private instance String variable. Add these instance meth...
A:
Q: What is the origin of the Colossus machine?
A: Colossus was a set of computers developed by British codebreakers in the years 1943-1945 to assist i...
Q: WRITE C++ PROGRAM: Typhoon Casualties. Write a program using arrays to enter the following dat...
A:
Q: Is it nossible to find out when the first programming Janquage was created?
A: given - is it possible to find out when the first programming language was created
Q: Define the characteristics that are required for test-driven development. In the event that you wish...
A: According to the question essential principles of check pushed improvement TDD and assuming that you...
Q: Who was the inventor of the world's first digital computer?
A: Digital computer: Digital computer is the one of the machine. Digital computer is the most commonly ...
Q: Assume we are using the simple model for floating-point representation as given in this book (the re...
A: a) Converting given 100.0 into binary.10010= 11001002 Converting binary number to the power of 21100...
Q: In computer memory, how do local declarations get put in place? Yes, but there aren't any good reaso...
A: Introduction: Memory Allocation: The technique by which the software creates "space" for informatio...
Q: Consider the following Python program (note that Python uses indentation to specify scope): 010 x = ...
A: Indentation is mandatory in python to define the blocks of statements
Q: Discuss security threats to databases and their respective countermeasures
A: Your answer is here given below:-
Q: Example-3: Write a program to calculate the Area and volume for a sphere Sol. -The area of sphere = ...
A: #include<stdio.h> int main() { float radius, area, volume; printf("Enter the radius of a spher...
Q: Problem (a): Consider the input image {227 3 6; 9 4 6 1 5; 8 5 2 4 6; 3 1 2 6 3; 6 4 5 3 7} with 2x2...
A: Here the input image is given as: 2 2 7 3 6 9 4 6 1 5 8 5 2 4 6 3 1 2 6 3 6 4 5 3 7 st...
Q: Big data has become a part of every organization's information technology systems in today's world. ...
A: Big Data is essential part of the every organization I have mentioned benefits and drawbacks of it b...
Q: Define the characteristics that are required for test-driven development. In the event that you wish...
A: According to the question essential principles of check pushed improvement TDD and assuming that you...
Q: computer Is there anything you know about Ada Lovelace's ideas?
A: Ada Lovelace (Ada) Lovelace (Ada) Love: Ada Lovelace was a brilliant mathematician, author, and aris...
Q: 1. ro = r1 & (~r2) 2. If carry is set , then ro := r1 +5
A: The answer is
Q: 'Rabenstein code was used to send a message with 4 information bits, you receive 100110001,
A: The answer is
Q: In the case of a buffer, what happens to the data?
A: Introduction: When moving data from one location to another, it is necessary to employ a data buffer...
Q: What kind of electricity does a computer consume?
A: The solution of your question is given below step.
Q: Consider the following Python program (note that Python uses indentation to specify scope): 010 x = ...
A: Introduction: Here we are required to find the variables accessible in the body of sub2()
Q: Create a C# function that takes a number (from 1 to 12) and returns its corresponding month name as...
A: I give the code in C# along with output and code screenshot
Q: Write a script titled HW5.m that • Uses both methods to compute the hangtime of a projectile, with a...
A: Solution: Given,
Q: iven this statement: “Garfield is a cat who loves to eat tuna. Tuna is a kind of fish, and fish norm...
A: Semantic networks are alternative of predicate logic for knowledge representation. we can represent ...
6. Find the output of the given code if it is compiled on a 64-bit system.
#include <stdio.h>
int main()
{
char *ptrToChar;
int *ptrToInt;
float *ptrToFloat;
printf("%ld ", sizeof(ptrToChar));
printf("%ld ", sizeof(ptrToInt));
printf("%ld ", sizeof(ptrToFloat));
return 0;
}
To find the output of the given C program if it is compiled on a 64-bit system.
Basic Information about the program:
Three pointer variables are declared and then the size of the pointer variables is printed in the output using the sizeof() function.
Step by step
Solved in 3 steps with 1 images
- #python def add_func(a,b): print(f"add_func output for 1 + 2: {add_func(1, 2)}") print(f"add_func output for good + day: {add_func('good',' day')}") (add_func(1,2) = 3, (add_func('good',' day') = "good day"Code write () 9.1. Modify the supplied program template to make an infinite loop that a) calls code25writer; // display a barcode on the VGA screen b) waits for a keypress on PB0; c) calls code25reader; // decode a barcode from the VGA screen d) waits for a keypress on PB0; e) repeats from a).
- // // main.c // Assignment1 // // Created by Hassan omer on 15/10/21. // #include <stdio.h> # include <stdlib.h> int input(); int multiples(); int cions(); void display_change(); int main() { int num; num = input(); multiples(num); cions(); display_change(); return 0; } int input(int num) { printf("enter 5-95 number\n"); scanf("%d",&num); return num; } int multiples(int num) { int sum5 =0; if (sum5 %5 != 0 ||sum5<5|| sum5 >95) { printf("invaild input %d",sum5); } cions(sum5); return sum5; } int cions(int sum05){ int cent50 = 0; int cent20 = 0; int cent10 = 0; int cent05 = 0; if (sum05 > 0) { if (sum05 >= 50){ sum05 -= 50; cent50++; } else if (sum05 >=20){ sum05 -= 20; cent20++; } else if (sum05 >= 10){ sum05 -=10;…Consider the producer-consumer problem where the producer produces items to be consumed by the consumer. A solution of the problem is to be implemented using threads. The main process will run producer and consumer as two different threads. The producer will put the items it generates into a buffer of length 15. The consumer reads the elements of the buffer to get the items. A solution is given below. Each item produced and consumed are also printed to the screen. Run the program several times and find a sample run when the items produced are not correctly consumed. Explain why the program does not always work correctly.Q1/ False or True 1- Assembler translates a program written in a low-level language to machine language. 2- C++ used to create system applications. 3- float is acceptable identifier. 4- int T=2.5; 5- The sizeof float is 4 bits. 6- The output of this program is 2. int main() { int i=8, j=3; float div; div= i/j; cout<< div;
- 1. Write a C++ program that accepts an array of numbers and determines and displays the largest number. See sample output below. Use dynamic memory allocation. Enter array size: 5 Enter 5 numbers: 5.92 1.92 3.96 9.8 6.4 The largest number is 9.8Using C++ programming language: Assume intptr is a pointer to an int. Write a statement that will dynamically allocate an array of 100 integers and store its address in intptr. Also, write a statement that will free the memory allocated in the statement you just wrote.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
- int main(int argc, char **argv) { float *rainfall; float rain_today; // rainfall has been dynamically allocated space for a floating point number. // Both rainfall and rain today have been initialized in hidden code. // Assign the amount in rain_today to the space rainfall points to. return 0; }int func(int a, int b) { return (avoid show_byte(byte_pointer start, int len) { Q2 int i; for(i=0; iSEE MORE QUESTIONSRecommended textbooks for youDatabase System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSONC How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag…Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill EducationDatabase System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSONC How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag…Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education