Q: In addition to a spinal column, what key feature distinguishes members of Vertebrata from Chordata?…
A: Animals can be differentiated on the basis of the presence of backbone. Species with notocord or…
Q: Q16. A mother and father with normal vision have a colorblind Klinefelter son. Colorblindness is an…
A: When a male develops Klinefelter syndrome, he has an additional X chromosome, which causes his…
Q: present case studies of biotechnology implementation in Belize Agriculture, highlight specifc crops…
A: Biotechnology has revolutionized agriculture globally, including in Belize. Through the application…
Q: QUESTIONS 1. What does the gradual change to red indicate in terms of the pH of the solution? 2.…
A: Photosynthesis is the process by which chlorophyll containing organisms produce organic molecule…
Q: Sophie's allele
A: DNA profiling, also known as genetic fingerprinting or DNA typing, is a forensic technique used to…
Q: Explain the current model of DNA replication including the key enzymes, and describe the different…
A: DNA replication is a fundamental process in which a DNA molecule is copied to produce two identical…
Q: Draw a labelled diagram to support the basic transcription steps
A: Transcription is the method of replicating hereditary data held in DNA into RNA. This process takes…
Q: 2. "My Life As a Protein" Write a short story about your life as a chemical message/protein that was…
A: The question prompts a creative exploration of the life of a protein, taking into consideration its…
Q: Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts.
A: When an RNA transcript is first made in a eukaryotic cell, it is considered a pre-mRNA and must be…
Q: Saying Flowered flavors instead of flowered favors is an example of what type of speech error? 1.…
A: A speech error is a deviation from the intended form of an utterance. There are different types of…
Q: 1.) Which of the following describe an ecosystem? A) Living and nonliving components of an area.…
A: In nature different species lives together and interact with each other. They form population,…
Q: Explain how memory cells strengthen the immune response when a pathogen is encountered for a second…
A: Immunity refers to the resistance exhibited by the host towards injury and diseases caused by…
Q: If a codon found in the mRNA sequence Tessa CGA, the tRNA anticodon that would bind to that codon…
A: In protein synthesis, the mRNA sequence is read in codons, or sets of three bases. These mRNA codons…
Q: A solution with more SH-ions than H+ ions would be O basic O acidic O neutral
A: Biochemistry examines the chemistry of living things and the molecular underpinnings of the…
Q: Complete the following tasks. You are fresh recruits to a molecular biology laboratory, and your new…
A: The polymerase chain reaction (PCR) is a technique for amplifying DNA sequences in the lab. The…
Q: You will create a hand drawn, 2-dimensional, labelled diagram of the plasma membrane (not a 3D…
A: The plasma membrane is the boundary of a cell that regulated the entry and exit of different…
Q: syringes below, answer these six questions: QUESTIONS 1. Which syringe had the most floating disks?…
A: By the data given in the question we can see that this experiment is very much related to…
Q: The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The…
A: Transcription - Transcription refers to the process by which genetic information encoded in DNA is…
Q: Fill in the blanks using the following terms: more, less, equal, in, out, zero, plasmolyze, swell,…
A: Understanding the behavior of plant cells in different types of solutions is fundamental to…
Q: write an article on the role of the microbiome for human health: from basic science to clinical…
A: The microbiome refers to the vast community of microorganisms that inhabit the human body,…
Q: How could you determine the volume a marble using water displacement? (Hint: The figure below shows…
A: To determine the volume of a marble using water displacement, below steps can be followed:Prepare a…
Q: What proteins are crucial for creating and maintaining DNA replication forks? Choose the best…
A: Replication in the process in which double stranded-DNA is duplicated or copied to produce two…
Q: When you test cross DdSsNn, you obtain the following numbers of offspring with the following…
A: If the genes are located on the same chromosome then they are classified as linked genes. In that…
Q: 2. Many health issues have been discussed throughout the semester. Identify a lifestyle choice that…
A: Life style change means modifying things we each have control over like changes in diet on daily…
Q: method used in lab? we will be using the filter disk method. Which is NOT true of the filter disc A…
A: Filter disc method is a method which is used to test the anti microbial property of different kinds…
Q: Biological Example 2: Mutation Accumulation Mutations caused by carcinogens such as solar radiation…
A: The question portrays a situation in which mutations caused by carcinogens such as solar radiation…
Q: Which of the following is not part of the early cell theory? A)All organisms are multicellular.…
A: 1.) The early cell theory has three fundamental components: (1) All organisms are composed of one or…
Q: If want to express the gene from monkey, the PET vector or BACMAN would be best? Briefly explain
A: The decision between PET and BACMAN vectors for expressing a gene from a monkey depends on several…
Q: in its cell membrane has been added to a solution that contains 0.5 M glucose and 2.8 M NaCl. The…
A: Activated protein may help in the transport of Polar molecules. This is eventually assisted by…
Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…
Q: which tree is correct? If both are not correct, pls provide the correct answer.
A: A phylogenetic tree is the diagrammatic representation of evolutionary relationships between…
Q: Using the given pedigree chart, suppose individuals III-1 and III-2 are expecting their sixth…
A: Sickle cell anemia is autosomal recessive disorder. Hence 2 mutant genes are needed to form the…
Q: Autosomal Recessive Disorder: Cystic Fibrosis 2. Cystic fibrosis is lethal autosomal recessive…
A: An autosomal recessive trait is a genetic condition or characteristic that is expressed when an…
Q: What is the role of Agrobacterium tumefaciens in the production of transgenic plants?
A: Agrobacterium tumefaciens is a natural genetic engineer that inserts its own DNA into the plants it…
Q: Use a diagram to show how a condensation reaction joins amino acids together
A: In the fascinating world of biochemistry, amino acids serve as the building blocks of life. Through…
Q: Which of the following applies best to post-translational control? Question 13 options:…
A: Translation is a process in which synthesis of protein takes place from the mRNA. During protein…
Q: 6. Contrast what is going on with the bacteria at arrow A with those at B. As you discuss your…
A: Bacterial resistance refers to the ability of bacteria to survive and grow in the presence of…
Q: Examples of tumor suppressor genes include? (select all that apply) G1 CDK-cyclins p53…
A: Genes responsible for the suppression of tumors. Acting against the formation of tumors . Tumor…
Q: According to Damron, aquaculture accounts for what percentage of total US cash receipts of total…
A: could not find any information on the percentage of total US cash receipts of total animal…
Q: is located immediately on top of the brain stem contains centers controlling coughing. swallowing,…
A: The swollen part of central nervous system located in brain box, having cavities filled with…
Q: What is the function of polymerase 2? To work on the repairing the DNA created. To only work on the…
A: DNA carries the genetic information of the organism stored within the nucleus and also plays a role…
Q: Base on your understanding of plant and animal cell osmosis, what condition do you think plant cells…
A: Osmosis is the movement of water molecules through a semipermeable membrane from a low solute…
Q: Identify the kind of fin shown for each diagram. 1 2 3 4 5 DONE The shape of the caudal fin is DONE…
A: Fish are amazing animals that have evolved to live in different aquatic environments over millions…
Q: What can the release of histamine and other chemical mediators from the mast cells in the airways…
A: Immune cells known as mast cells are important components of the immune system. Although they can be…
Q: Calculate selection for the following scenario. In a population of prairie dogs living on a…
A: The concept of selection plays a significant role in shaping the genetic composition of populations.…
Q: How is this cell different from a typical plant cell? D VOCAL
A: Cell is the basic structural and functional unit of cellular organisms. All the cells are divided…
Q: What is Schistosomiasis? write a short paragraph about Schistosomiasis
A: A plant or animal that lives on, alongside, or inside a larger species and extracts nutrients is…
Q: How will you measure the the zones of inhibition for exercise 6-7, 6-8 and the Kirby-Bauer meth By…
A: How will you measure the the zones of inhibition for exercise 6-7, 6-8 and the Kirby-Bauer method By…
Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…
A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…
Q: Transplant rejection is inevitable’. Argue for and against this statement including in your answer…
A: Transplant rejection refers to the body's immune response against a transplanted organ or tissue. It…
Step by step
Solved in 4 steps
- Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is locatedName: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anpen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorderTRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…
- Analyzing mRNA Sequences 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Glutamic Acid-Glutamic Acid- COO 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Valine-Glutamic Acid-CO (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA otein 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair → rules for RNA! AU TA VERSION 1 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 nucleotide sequences called CODONS. Use the codon chart to find the correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G Cheatham G C oints Fuer DNA TAC ATA A CA GTC стт TAG CT A AT C TAC T GG ACA GGT ACC ATA ACT = activity you mber to deter = may code Fuer MRNA veral thousar ctivity takes on 2). And se AA o pp DNA TA C C G T CcC A GT GT C T G C A A A ACT TAC GACAGC TAC GT G G C T сс ATC Turn in lete all tables MRNA AA n Synthesis mment DNA TAC сТА CT T G T C T T G G C C ACG AT T TAC CAT C C G GA C GG G TAC T TA A T C Class comme to Sea aclass comm MRNA AAMutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?
- TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA | 1. Transcribe the DNA strand into MRNA. Don't forget the special base pair rules for RNA! AU TA veRSIon 2 2. Translate the MRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C IGG GGI G IC CIC IAG CIA AIC Iac IGG ACG ccc Acc AI G DNA TAC GGT ATI MRNA AA DNA TAC CAT I AC CGI cCc IC G GTT A IC IA C A AC AGG CCI IIG GCT CCG ACI MRNA AA DNA I AC I T G GII CIC CIG ICI A C A ACI IAC CAI CGA IT G G GG TGI TAG A T C MRNA AA Decide if you want to illustrate a horse, coyote. or a cat - get the phenotype information from your teacher.Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTTMutated DNA Sequence #1 TACAT C TTG C G A C GAC T... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?
