family DNA. (10 Pts) A. To compare, transcribe DNA to mRNA and translate (to amino acids) each DNA template WT & Family) for part of the gelsolin gene. Assume codons are as separated by spaces (...) means sets of three codons removed to shorten sequence examined. XTI or
Q: 11. In the carbon cycle, atmospheric carbon dioxide is converted into organic (living) material by…
A: The exchange of carbon between the biosphere, pedosphere, geosphere, the hydrosphere, and atmosphere…
Q: What bonds hold dna based together
A: DNA (deoxyribonucleic acid) bases are the building blocks of DNA. There are four types of DNA bases:…
Q: 16. Use these 6 phrases and write them in the mitochondrial area that they best describe. High [H+]…
A: Mitochondria are organelles found in most eukaryotic cells, responsible for producing energy in the…
Q: Which of the following evolutionary mechanisms can drive genetic divergence after the genetic…
A: This is a multiple-choice question that asks about the evolutionary mechanisms that can drive…
Q: one to three sentences, describe what happens during the reduction stage of the Calvin cycle.
A: The Calvin cycle is the series of light-independent reactions or dark reactions, that convert…
Q: b) How would you expect the voltage-gated K+ channels to affect the shape of the action potential?
A: An action potential is a rapid changes chenge in the membrane potential or voltage across a membrane…
Q: One potential advantage of sexual reproduction is that offspring will have more genetic…
A: Sexual reproduction involves the fusion of gametes from two different individuals resulting in…
Q: Question 2. Which laboratory method can be used to quantify levels of all mRNAs expressed in samples…
A: RNA sequencing or RNA-seq is a powerful laboratory method used to quantify the expression levels of…
Q: Describe the mechanism of Cortisol and how it works to produce an emotion.
A: Cortisol is a steroid hormone produced by the adrenal glands in response to stress. It plays a…
Q: Please answer both, thank you
A: During gastulation of embryonic development the process of formation of neural tube is called…
Q: Why do we see fluctuations in blood pressure for the left ventricle, arteries, and arterioles, but…
A: Blood will exert force against the walls of blood vessels is known as blood pressure. It differs…
Q: The process of co-metabolism, where the waste products of one organism serve as nutrients for the…
A: Co-metabolism is a type of metabolic pathway in which two or more organisms, typically different…
Q: In cats, the locus for orange coat color is sex linked. Male cats that are black have the o+ allele,…
A: This problem involves determining the probability of a specific offspring phenotype resulting from a…
Q: Give typing answer with explanation and conclusion The 3' end of Cucumber Mosaic Virus RNA4 most…
A: In the transmission of genetic information, RNA comes in a variety of forms and serves a variety of…
Q: Which term refers to a person's long-term pattern of attraction to partners? sexual initiation…
A: Your sexual sensations, thoughts, desires, and acts towards other people are all part of your…
Q: Use this typical bacterial growth curve to answer the following 3 questions. y axis = log cell…
A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…
Q: What other microbiology tests should I perform to seperate proteus mirabilis, salmonella typhi,…
A: ANSWER) Some tests to eperate proteus mirabilis, salmonella typhi, Serratia marcescens, and Shigella…
Q: Organ Lymph nodes Tonsils 4. Thymus along the course of the lymphatic vessels 2. 5. 6. Location…
A: As per Bartleby guidelines, an expert cannot answer more questions at a time. So, kindly post other…
Q: Where do you see the future of medical anthropology going? What is a local or global health issue…
A: Human health and disease, healthcare systems, and biocultural adaptability are all studied in…
Q: What property of RNA makes it capable of carrying out the functions of a ribozyme? What may be…
A: Ribozymes can catalyze a wide range of chemical reactions, including self-cleavage and ligation, RNA…
Q: Cells from mouse spleen were fixed and stain with CD4, which is found on T cells. Are the lighter…
A: In this scenario, cells from a mouse spleen are stained with an antibody targeting CD4, a protein…
Q: $$ R ANSWERING QUESTION 4 Chromosome Pair 1 X XX agram above represents the condensed chromosomes at…
A: Meiosis involves two divisions. First one is reduction division and the second one is equational…
Q: What is the Red Queen Dynamic? Using the snail example, explain why different parasite and host…
A: The Red Queen Dynamic emphasizes the significance of evolution as well as adaptation in creating the…
Q: These 5 words must be present in your paragraph for the american holly tree DNA, Mendelian, protein,…
A: 1) protein is a large molecule that is made up of chains of smaller units called amino acids. These…
Q: Q24: Industrial Residues Make a study on the processing of residues originating from an industrial…
A: Industrial residues are materials that are left over or generated during various industrial…
Q: Suppose you were given two jars one containing an amino acid and the other contains a polypeptide.…
A: Ninhydrin and biuret reagents are commonly used in biochemical assays to identify amino acids and…
Q: What are the best practices for managing medication administration?
A: The act of administering medication to a patient safely and effectively is referred to as medication…
Q: From a global health viewpoint howdoes HIV/AIDS fit into either the ecological/evolutionary model…
A: HIV stands for Human Immunodeficiency Virus. It is a virus that attacks the immune system,…
Q: What specific evidences can be used to support the statement that “The importance of the effect of…
A: The physiological functions of an organism are mediated by numerous proteins. Proteins have several…
Q: Red-green colorblindness in humans is caused by a sex-linked recessive allele. A color-blind man…
A: A Punnett square is a diagram used to predict the possible genotypes and phenotypes of the offspring…
Q: Which of the following methods are considered sexual propagation? Group of answer choices…
A: Sexual propagation and asexual propagation are two different methods used for the reproduction of…
Q: What is the difference between within-host selection and among-host selection?
A: A host is an organism that provides a home, habitat or source of nutrition for another organism…
Q: What is the difference between primary and secondary immune deficiencies? What was the first primary…
A: Immune disorders are conditions that affect the immune system's ability to function properly. These…
Q: New species only evolve from two previously existing independent species, never hybrid species…
A: Speciation is the process by which new species arise. It occurs when a population becomes…
Q: 53. The DNA sequence from which a functional non-coding RNA is transcribed is often called an RNA…
A: The fundamental structural and operational unit of heredity is the gene. DNA nucleotides make up the…
Q: Why DNA is stored cold with the InstaGene matrix after boiling the samples?
A: Insta gene matrix provides quality DNA for PCR in less than an hour so this method is easy and cost…
Q: Choose one genetic technology and explain the ethical, social and legal considerations associated…
A: The term genetic technology describes the application of scientific methods to alter the genetic…
Q: Evidence Question #5 1. Cholesterol is abundant in the plasma membrane. Would you expect cholesterol…
A: 1. Cholesterol is abundant in the plasma membrane. Would you expect cholesterol to flip between the…
Q: Red/green colorblindness is inherited as an X-linked recessive trait in humans. A woman with normal…
A: Recessive inheritance that is X-linked occurs when the gene for the trait is found on the X…
Q: Describe the movement in ions in action potentials of these cells - pacemaker cell - cardiac…
A: Series of changes in various ion concentration such as calcium, sodium and potassium ions that…
Q: Why is penicillin toxic to bacteria but not to higher organisms? Explain 2-3 sentences
A: Penicillin is an antibiotic that was first discovered in 1928 and is widely used to treat bacterial…
Q: Which of the following results in filtration? 1) hydrostatic pressure in the peritubular capillaries…
A: Filtration is the process by which fluid and solutes are driven through a filtration membrane and…
Q: #4: Ch. 20- Hardy-Weinberg The ApoE gene has three common alleles: E2, E3 and E4. A population…
A: The Hardy-Weinberg law also known as the Hardy-Weinberg equilibrium or principle is a fundamental…
Q: Why does global self-esteem tend to decline in early adolescence? having to make multiple…
A: During early adolescence there are many changes happening in an individuals life including physical…
Q: 8) Triglycerides make up the main form of lipid storage in: a. Plants b. Fungi c. Animals d.…
A: Triglycerides are the main form of lipid storage in animals, including humans. They are composed of…
Q: Hypothetically draw the Dichotomous key for Bacillus subtilis, Bacillus, Megaterium, Bacillus…
A: A dichotomous key is defined as a method that enables the user to identify organisms by selecting…
Q: Glucose-6-phosphate isomerase is used to do which of the following steps of glycolysis
A: The metabolic pathway where glucose is converted into pyruvic acid is known as glycolysis. These…
Q: Liquid supported membrane of DGA used for rare earth elements separation. Tell me the…
A: liquid-supported membrane of di-(2-ethylhexyl) phosphoric acid." It is a type of membrane used for…
Q: 1. Create an inversion on your mini gene that results in Comments and help an inversion. 5'…
A: By convention, we arrange DNA sequences from the 5' end to the 3' end. As a matter of tradition, the…
Q: Why and how might antibodies againt IL-6 or IL-6 receptor be used for treating patients with…
A: Diseases like COVID-19 are dealt with by the immune system significantly by interleukin-6 (IL-6). In…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. GGG A- GG C TA GCTG ||||| ||||| || || | ||| || | -CC GAT C GACGA AGG AACCCCT-Figure 16.13 An increase in phosphorylation levels of elF-2 has been observed in patients with neurodegenerative diseases such as Alzheimer’s, Parkinson's, and Huntington's. What impact do you think this might have on protein synthesis?II. Give the translation of the segment of a polypeptide chain below. Specify your template strand. -GG CT |||||| -c C GATC G ACGAAGGAACCCCT- GGGGA- |||||
- 6. Please describe the events that may result in a mature protein not having methionine asthe N-terminal amino acid.1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size was analyzed for mutations. As a result, „UAA,,codon was found. What type of mutation is this? To answer the question, please explain: I) what is a single nuclcotide polymorphism? 2) how it affects the protein function?
- 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant form are shown. By consulting Table 3-1 in your textbook, determine the double-stranded sequence of the corresponding section of the normal gene. Which strand is the strand that RNA polymerase "reads" and copies? What would the sequence of the resulting mRNA be? What kind of mutation is the mutant protein most likely to represent? Normal -lys-arg-his-his-tyr-leu- Mutant 1 -lys-arg-his-his-cys-leu- Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5-...-AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG- GGC-GGA-AAA-UUU-UAA-3 Using…1a. What is the basic structure of a nucleosome? Also what's the key characteristics of histone proteins?
- 1. Using the following DNA sequence determine the amino acid sequence: 3'TACCAGAGGTCCGCGTTTAGACAT5' a. Met Val Ser Arg Arg Lys Ser Val b. Val Leu Pro Gly Arg Lys Ser Met c. Met Ser Lys Arg Gly Pro Leu Val d. Val Ser Lys Arg Arg Ser Val Met I know the answer is A, but how do I do it? indicate if each statement refers to prokaryotic cells, eukaryotic cells or both. 1. leading and lagging strands form during DNA replication c 2. 80S complete ribosomal subunit 3. DNA replication is coordinated to the cell cycle. 4. Circular DNA1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?9. Which of the following mutations would be least detrimental to the function of a protein and why? 1) Silent; 2) Frameshift; 3) Deletion of two nucleotides; 4) Nonsense; 5) Missense. dreenn ет