Explain how the information in mRNA is converted into a fully folded protein, and how the misfolding of proteins can result in disease, giving an example of such a condition. please expain indded with example

Explain how the information in mRNA is converted into a fully folded protein, and how the misfolding of proteins can result in disease, giving an example of such a condition. please expain indded with example

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 8LO: Identify the features of tRNA that are important in decoding genetic information and converting it...

See similar textbooks

Related questions

Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)

A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…

Q: Polypeptides are continuously synthesized and broken down within living systems. One of these…

A: A protein is a chain of amino acids which can be called a polypeptide. The polypeptide chain folds…

Q: Which of the following is true about myoglobin and/or hemoglobin?nd a. The iron in hemoglobin is in…

A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…

Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…

A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…

Q: Explain how energy stored in pyruvate is converted into adenosine triphosphate (ATP) in eukaryotic…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: ½ O₂ + 2H+ +2 e → H₂O FAD + 2H+ + 2e → FADH₂ E'º = 0.816V E'º = -0.219V Calculate the AG" of the…

A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…

Q: In cardiac muscle cells, the sodium-calcium exchanger maintains a low Ca²+ concentration in the…

A: When we consider an ion, say A, moves from inside a membrane to the outside, the free energy of the…

Q: What is the name of this cofactor related to niacin? 0

A: Enzymes are proteins that catalyse biochemical reaction. Sometimes enzymes require a non protein…

Q: Briefly describe the role of the heat shock protein Hsp70 in protein folding.

A: Heat shock proteins (HSPs), also referred to as stress proteins, are a group of efficient proteins…

Q: Does the complete oxidation of tridecanoic acid (C13:0) make more ATP than the complete oxidation of…

A: Triacylglycerols are stored form of lipids in the body. When there is a lack of energy and…

Q: Which of the following are correct Dynein head elongates like a lever arm. ATP…

A: Movement of the body part is done by contraction and relaxation of contractile proteins.…

Q: po Which of the following non-covalent interactions is the driving force in the initial…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: The inhibition of PFK-1 by ATP diminishes when the ADP concentration is high, as shown in the graph…

A: PFk-1 is an enzyme involved in glycolysis. It catalyzes the conversion of fructise-6-phoaphate to…

Q: Explain how glucose can be created from other molecules under starvation conditions.

A: Animals—including humans—use a complex set of hormonal and metabolic adaptations to help them endure…

Q: Answer each question in the figure regarding reactants and products in the isocitrate dehydrogenase…

A: In the citric acid cycle, isocitrate dehydrogenase catalyzes the oxidation of isocitrate and…

Q: Draw the synthesis of the dinucleotide formed between ATP and GMP. The 5' triphosphate can be…

A: Guanosine Monophosphate kinase catalyze the phosphate transfer reaction in which the terminal gamma…

Q: . Effects of amino acid composition and sequence to protein folding

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: is this protein folding funnel from a metamorphic protein? yes or no? is there one intermediate…

A: Anfinsen hypothesis postulates that under native conditions, the three-dimensional structure of a…

Q: The question is not being answered for either of them. What is the maximum ATP including converting…

A: Electron Transport Chain (ETC) located in the inner mitochondrial membrane, consist of four protein…

Q: What is the direct source of energy that powers molecular motors? proton gradient H+ gradient…

A: Molecular motors are proteins that generate motion within the cell for various activities like…

Q: Mucic Acid Test for Galactose and Lactose Galactose, on being oxidized with HNO3 forms mucic acid,…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified into monosaccharides,…

Q: The catalytic activity of enzymes depends on the presence of appropriate environmental conditions.…

A: Pepsin is a digestive enzyme found in the stomach. It is a type of hydrolase enzyme that help in…

Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…

A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…

Q: Given a peptide chain that is composed of the following amino acids: (branched chain-- polar…

A: Chromatography is a separation technique by which amino acids dissolved in a mobile phase are…

Q: Sample w/ water w/ pancreatin Observation Exploratory questions: 3. What type of hydrolysis is used…

A: Animal fat and vegetable oils are simple fats or triglycerides. Triglycerides are fatty acid esters…

Q: Given this peptide chain: LYS – MET – ASP – THR – GLN – ARG- LYS – TRP – MET – LYS – GLU – VAL- ARG…

A: Using chromatography, a compound can be separated from a mixture of compounds. There can be various…

Q: A student wanted to load .75 ug dna on agarose gel and has 4x loading buffer for sample preparation.…

A: Agarose gel electrophoresis is a method used for the separation of DNA fragments which is stained by…

Q: Which of the following statements about gluconeogenesis is TRUE? Gluconeogenesis is one way to…

A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…

Q: What is the purpose of the non-cyclic photophosphorylation? To generate NADPH for the…

A: The photophosphorylation that occurs in the grana of thylakoids in a non cyclic manner in which both…

Q: The total degradation of a fatty acid with an odd number of carbons yields acetyl-CoA and another…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…

Q: D-Talose is a C2 epimer of D-galactose. Using the Fischer projection structure, draw the product of…

A: The structure of D-Talose is given below.

Q: Show the structure of each intermediate in the conversion of b-hydroxybutyryl-ACP to butyryl-ACP by…

A: De novo fatty acid synthesis is also called as Lynen's spiral is a set of reactions catalysed by a…

Q: 9. In pre-historic earth, where there exist no protein enzyme, ribozymes (ribose enzymes) seems to…

A: The most significant molecules in cell biology are deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: Macmillan Learning All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E'° for…

A: The value of free energy change helps to determine the spontaneity of a reaction. A positive ∆G…

Q: Compare and contrast glycerophospholipids and triacylglycerols(functions, structure), including…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: Please explain the formula (process) used to get the Red undelived numbers, Thanks!! example each…

A: Enzyme kinetics - Enzymes are usually comprise of protein molecules which is used to catalyzed…

Q: Which of the following enzymes is inhibited as a result of insulin binding to its receptor? glycogen…

A: Insulin regulates the level of blood glucose by stimulating the uptake of glucose from the blood…

Q: Choose the correct answer from the options in brackets. The [positive/negative] standard…

A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…

Q: C) using Fischer Projection, draw each for the payoff phase of glycoly in 6.) G13 P 1, 3-bPG 3) 3PG…

A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…

Q: How many ATPs are generated in the reaction: Glucose to oxidation to 2 acetyl CoA via Glycerol…

A: A redox reaction is where oxidation and reduction occur simultaneously. In glycolysis, there is a…

Q: How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in…

A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate by…

Q: Biological value of phosphatidylethanolamine

A: A multifunctional phospholipid needed for a number of cellular functions, phosphatidylethanolamine…

Q: Which is true about signaling receptors? They are transmembrane proteins that have binding…

A: Signalling receptors are the transmembrane proteins that span the plasma membrane of the cell. they…

Q: a. What is the name of metabolite 1? b. What enzyme converts metabolite 1 to metabolite 2 (E1)? c.…

A: Nucleic acids are macromolecules composed of nucleotides. Nucleotides are joined together through…

Q: The first step in the catabolism of most amino acids is which of the following? Transfer of alpha…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…

Q: 1. Using Fischer Projection, draw each of the reaction. for the investment phase of Glycolyse 1…

A: Carbohydrates consumed in diet are oxidised via the glycolysis pathway. Carbohydrates are first…

Q: Why might a person who is gravely ill not want to participate in a placebo-controlled drug study?

A: Placebo-controlled drug study is a study done where one group of participants are given the actual…

Q: Please describe four different modes of the regulation of the pentose phosphate pathway.

A: The pentose phosphate pathway (PPP) is a multienzyme pathway that shares a common starting molecule…

Q: The basic elements or molecules of cell signaling I. second messengers - substances that enhances…

A: Biochemical cell signalling is the method by which cell communicates with each other cells and…

Q: A protein has a dissociation equilibrium constant equal to 4.0um. What is the concentration of free…

A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…

Question

Explain how the information in mRNA is converted into a fully folded protein,
and how the misfolding of proteins can result in disease, giving an example of such a
condition.

please expain indded with example

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Explain how the translation and degradation of an mRNA may be controlled by RNA-binding proteins.
list all the steps required for mRNA to be translated into a protein
An mRNA may contain the sequence ATTGACCCCGGTCAA True/False
Alternative splicing allows for more proteins to be made from the same region of DNA; explain how you can get multiple proteins from the same DNA. Then explain if alternative splicing changes the DNA and/or the mRNA. Draw or diagram out an image to depict this.
The set of mRNAs present within a cell changes over time.Explain.
What is the total size of the mature i.e. fully processed mRNA in nucleotides?
Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
The relaxation of base-paring rules between the TRNA and MRNA is termed as Answer:
Name and explain the process by which mRNA is formed.
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCA
Some cells can regulate gene expression by using microRNAs (miRNAs), that bind to complementary sequences on mRNA molecules in the cytoplasm increasing the stability of mRNA molecules and their rate of translation. Select one: True False
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCA