Drag an arrow in the appropriate direction of travel for DNA Helicase Replication fork Trihoshate Okaa gment Lain 10 ONAgae hinai DNA pelymerase DNA pelymirase
Q: Where is CSF usually obtained for examination and explain why.
A: Cerebrospinal fluid (CSF) is a clear, colourless bodily fluid found in the tissue that surrounds all...
Q: Name three human activities that can promote soil erosion. Describe six farming methods that help re...
A: These human activities that can promote soil erosion includes: overgrazing deforestation human ind...
Q: The proteasome is a multi-subunit machine that unfolds anddegrades proteins. How is its activity reg...
A: The proteasome is an exceptionally refined protease complex intended to complete particular, effecti...
Q: What does a mechanically gated channel respond to?a. physical stimulusb. chemical stimulusc. increas...
A: Although the cell's membrane is selectively permeable, only a few molecules can cross it directly. I...
Q: . _____ include all species in the direct ancestral/evolutionary lineage of modern humans. a. plat...
A: Hominid is the group that consisting of all modern and extinct Great Apes that is, modern humans, ch...
Q: When excess nitrogen and phosphorus from local farms ends up, in river and inlets, what process can ...
A: Nitrogen and phosphorus are the two main primary nutrients in commercial fertilizers and they play k...
Q: How does natural selection cause evolution? Use evidence from the chart and explain how the chart su...
A: Natural selection is the process described by Darwin This process tells us that that certain trait...
Q: What do steroid and peptide hormones typically have in common? their solubility in cell membranes th...
A: The chemical substances that are synthesized and produced by the endocrine glands to control and reg...
Q: What are the advantages of using the gun in the ecosystem? Try to explain by mercy killing animals ...
A: Mercy killing of animals: it is also known as euthanasia in which animals are killed by using extrem...
Q: (a) E 25 24 23 1 2 3 Numbers per km? (b) 70 60 50 40 125 100 75 50 400 800 1200 Density (m-2) Gw 6) ...
A: Figure a- organism length indicate that species grown to a larger size at lower density however in f...
Q: Nucleotide Site 3 4 9. 10 Outgroup C G Sislaf rose C G G C G т C T Glozzom rose G G G A Pentwist ros...
A: Taxon on a tree A phylogeny, or evolutionary tree, represents the evolutionary relationships among a...
Q: DNA from a strain of Bacillus subtilis with genotype a + b + c + d + e + is used to transform a stra...
A: Introduction :- The basic physical and functional unit of heredity is the gene. DNA is the material ...
Q: Distinguish between alternative complement pathway and Lectin pathway.
A: Introduction: Complement proteins: A system of plasma proteins that can be activated directly by pat...
Q: identify the cell wall, cytoplasm, amyloplasts in the potato Parenchyma.
A: Cell wall in potato acts as semipermeable membrane. Amyloplasts are plastids or organelles that stor...
Q: What is the Pros and Cons of Cloning?
A: Answer Cloning is the brst way to increase the product in more number bearing the same generic mat...
Q: Males castrated at a young age will show receptive behavior to other males when treated with estroge...
A: There are few points about the gonadal harmones are : The testes in the male and the ovaries in the ...
Q: C) A) B) D) E) Directions: For cach of the following species above identify whether they are Haplorr...
A: Strepsirhines: B and C. Haplorrines: A, D, E. Platarrhines: A and B Catarrhines: D and E
Q: Signaling by soluble extracellular molecules can be classified as endocrine, paracrine, or autocrine...
A: The systems of signalling are classified that are based on the total amount of distance to which the...
Q: 1. Explain how DNA encodes genetic information. 2. Explain the role of complementary base pairing in...
A: Explain how DNA encodes genetic information The arrangement, or sequence, of the nucleotides along ...
Q: What are the trends of the gametophyte in the evolution of plants?
A: Introduction In this question we will discuss about the trends of the gametophyte in the evolution o...
Q: a. How does the genetic variation among humans compare to variation in other hominids and what does ...
A: The evolution is a event that occurs in the course of time and happens due to natural selection too....
Q: %2+ le to classify each animal in its Scavenget ectivere Omnie owing fom the school grounds a pue sa...
A: Part A. A carnivore is classified as an organism that eats meat the flesh of animals. They are al...
Q: In humans, discoloration of the teeth is controlled by the dentine sialophosphoprotein (DSPP) gene i...
A: The normal colour of teeth is white hue color, a slightly yellowish layer for protection.
Q: Which of the following descriptions does not apply to a multicellular fungus? the mushroom is a tran...
A: *A fungus ia an eukaryotic organisms that contains microorganisms like yeasts and molds and some mu...
Q: These sensory receptors when activated result in the movement of both calcium and sodiujm ions throu...
A: Sensory receptors play a key role in responding to stimuli. They can sense different sensations like...
Q: Broadly speaking, primates can be most active during the day or at night. Today most living Haplorrh...
A: Haplorhines and strepsirrhines are the suborders of primates.These two lineages have diverged and Ha...
Q: ria reproduce b
A:
Q: Photosynthesis removes carbon dioxide from the atmosphere and produces oxygen. O True O False
A: Photosynthesis is the process of oxygen generation and energy production (in form of sugar) by using...
Q: Which of these hormones inhibits gluttony or causes inappetence in animals? prolactin progesterone e...
A: Introduction:- A freemartin is a female twin who is sterile. This occurs because it is usual for dis...
Q: Define about competing endogenous RNAs (ceRNAs) ?
A: Competing endogenous RNAs (ceRNAs) are the recent developing areas adding to the complexities of miR...
Q: In humans, discoloration of the teeth is controlled by the dentine sialophosphoprotein (DSPP) gene i...
A: Recessive gene traits are the ones which are expressed only when two copies of the recessive genes a...
Q: The regulation of mRNA decay relies heavily upon deadenylasesand decapping enzymes. Explain how thes...
A: These classes of enzymes are critical to initiating mRNA decay by decapping of the enzymes that are ...
Q: What does the circled structure do?
A: Heart Mesodermally derived organ, is situated in the thoracic cavity between the lungs, slightly ti...
Q: How are male gametophytes and male gametes formed in angiosperms?
A: Introduction In this question we will write how male and female gametes are formed in angiosperms.
Q: Which is the order of glycolytic capacity between these muscle fiber types O I> lla > Ilx O Ix > la ...
A: The contraction of the muscle fibre is explained by the muscle contraction theory by the 2 muscle fi...
Q: Describe the organization of the interphase nucleus. Include inyour presentation a description of ch...
A: DNA is a molecule found in the nucleus by Friedrich Meischer in the late 1860s, but its function was...
Q: Compare the approach of setting aside protected areas with the approach of community-based conservat...
A: Community-based conservation is implemented at the local level with citizens, and local institutions...
Q: DNA from a strain of Bacillus subtilis with genotype a+ b+ c+ d+ e+ is used to transform a strain wi...
A: Co transformation means that the two genes are transformed simultaneously. Is two genes are co trans...
Q: When a living cell, which has an outer membrane made of phospholipids, is placed in an aqueous (wate...
A: We know that plasma membrane is a dynamic ,fluid structure and form external boundary of cells. It a...
Q: What are the main cells that compose poriferans?
A: Introduction:- Porifera is the phylum that contains the simplest animals in the animal kingdom. Spon...
Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet...
A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize mess...
Q: geometry on both cand N. Trigonal plannes -- NHZ CH ーCーN eーN CH2 HN CH-C-O4 (d- carbon) HooC Asparci...
A: According to our guideline we can answer maximum 3 subparts of a question. So upload the questions s...
Q: In rock pocket mice of the American Southwest, different extreme traits in mice of the same species ...
A: selection is a process in which certain natural traits are selected in an population that enhance th...
Q: summarize basic information with photos: Family name, scientific name, common name, hosts/damage, li...
A: The forest tent caterpillar moth is a moth found all through North America, particularly in the east...
Q: Do we have ethical obligations toward other species?
A: Ethics should be the every human activity wheather it is research or dialy life activity. Because al...
Q: 2 a) What does calcium do in a skeletal muscle cell and where in the cell does it come from? ...
A: Skeletal muscle contraction is a complex phenomenon and involves various processes requiring special...
Q: How gene therapy treatment affect our future?
A: Gene therapy is the process of modifying genes in your body's cells to treat or prevent illness. You...
Q: BFR Is an example of "gym science" that has no merit as a training tool was devised at Ball State Ex...
A: BFR stands for blood flow restriction It decreases the blood outflow in veins ( total cut off ) And...
Q: 1. You are studying an E. coli gene that specifies a protein. A part of its sequence is -Ala-Pro-Trp...
A: The mutation is a change in DNA sequence that is responsible for alternation of the amino acids in t...
Q: What is the body temperature difference of the follicular phase compared to the luteal phase? 2. ...
A: Menstrual cycle consists 3 phases.And they are Follicular phase and Ovulatory phase.And the stage in...
Can you help me with my homework?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Complete the complementary stand of the DNA shown Complementary strand стАG GTACT CAC GReplicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC. Translate your answer to #16 using the table below. Second letter A G UGU cys UGC UUU PheUCU UCC UCA UCG UAU1 UUC UUA UAC J Tyr Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUGLEU CAUTHIS CÁC CUU CUC CUA CUG CCU] CCC CCA CCG CGU] CGC Arg Leu Pro CAA GIn CGA CGG. CAGS ACU ACC ACA AAC FAsn AAA AGU Ser AGC AGA LArg Lys AGGJ AUU AAU AUC le A AUA The AUG Mer ACG AAGJ GAU ASP GACJ GUU GCU GCC GCA GCG GGU GGC Gly GUC Val GUA Ala GAAG Glu GAGJ GGA GUG GGG Third letter DUAG JCAG DUAG C. First letterGive the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
- of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, butAKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing rule
- Y-shaped region created when helicase unwinds a portion of a chromosome that serves as the growing site for DNA replication. origin of replication dispersive replication model semiconservative replication 0 0 0 0 О QUESTION 5 replication fork conservative replication model An enzyme in DNA replication that breaks the hydrogen bonds between the DNA strands to open up or unwind the DNA so it can be copied. DNA polymerase I helicase telomerase 0000 DNA polymerase III topoisomerase QUESTION 6 0 0 0 0 0 One of several processes by which genetic material in the form of "naked" deoxyribonucleic acid (DNA) is transferred between microbial cells. phosphodiester bond antiparallel strands Chargaff's rules complementary base pairs transformationart B-Processes occurring at a bacterial replication fork The diagram below shows a bacterial replication fork and its principal proteins. Drag the labels to their appropriate locations in the diagram to describe the name or function of each structure. Use pink labels for the pink targets and blue labels for the blue targ Replaces RNA primers with DNA nucleotides. Catalyzes phosphodiester bond formation, joining DNA fragments. Leading strand Breaks hydrogen bonds, unwinding DNA double helix. Synthesizes DNA 5' to 3 on leading and lagging strands. Lagging strand Coats single-stranded DNA, preventing duplex formation. Relaxes supercoiled DINA. Synthesizes RNA primers on leading and lagging strands. e Overall direction of synthesis reset ? helpment Lopez Chun 1 1006 is Diego 5. For the following DNA strand, complete the following: a. Write the complementary DNA strand below the strand. 5'-A CCTA CGTTC GACGTA ACCGCAT T-3' 3-T6G AT GCAAG CTGCATT GG C6TAA_5² b. Replicate the DNA strand (remember semiconservative replication). 5'-AC CTA CGTTCGAC GTAA CCGCATT-3' 3'- 5'- 3'- 5'-ACCGTTCGACGTAACCGCATT-3' - 5' 138 DNA and BLAST Lab Report - 3' - 5' OLD NEW NEW OLD c. Transcribe the 5' to 3'DNA to an mRNA strand (remember there is NO thymine in RNA). 5'-A CCTA CGTTCGACGTA ACCG CATT-3' DNA mRNA d. Take mRNA strand and convert to amino acid (protein) using mRNA codon table (Table 4). Remember mRNA is read 5' to 3' so you will need to re-write the sequence to begin with the 5'end. Start protein at the AUG sequence. mRNA Protein
- Indicate the proteins involved in the following steps of DNA replication in E. coli a. ___________ initiator of replication by binding to the origin of replication of the prokaryote ___________ a dimer that unzips the DNA helix ___________ an enzyme responsible for relieving positive supercoils ahead of replication fork ___________ maintains DNA in single-stranded state ___________ primary replicating enzyme ___________ synthesizes RNA primers The resulting gap by removal of RNA primer is filled in by ___________. h. the resulting nick is sealed by _____________.TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What would happen if the nitrogen base second to the last of the sequence will undergo a point mutation, (G turning to A) Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop The DNA sequence ATCAGCGCTGGC is part of a gene. how many amino acids are coded for by this message? O 4 8. 12 20 Option 5 For the lab part: how is DNA used for catching crime suspects. Describe the procedure and cite a particular example where it helped solve a case or absolved an innocent person from any wrongdoing. Your answer O O#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: