Q: Intracellular morphogens 1. 2. 3. 4. 1. 2. 3. 4. 234 Extracellular morphogens
A: Morphogens are the signallung molecules thar spread through the developing tissues and results in…
Q: estion 6! The largest chromosome in Mischievous gremlinus has a length of 9 x 107 base pairs. The…
A: The DNA molecule is bundled into thread-like structures called chromosomes in the nucleus of each…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: Gibberellins have variety of effects such as ___________, _________ and ___________.
A: Answer
Q: Punctuated Equilibrium is a hypothesis that ... O suggests that evolution is not gradual but occurs…
A: Punctuated equilibrium is a hypothesis that evolution of a species is marked by sudden isolated…
Q: is a normal cellular gene that through a A an oncogene. OA) proto-oncogene...loss-of-function OB)…
A: An oncogene is a cancer-causing gene that has been mutated. A proto-oncogene is a type of oncogene…
Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.
A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…
Q: Explain in detail the process of making beer with process flow diagram.
A:
Q: STUDY QUESTIONS 1. List down at least 3 differences in the anatomy of male and female frogs. 2. How…
A: Frogs are amphibians and humans are mammals.
Q: of
A: The main purpose to do homogenization of the milk is to break the large fat globules and then create…
Q: Determine whether each of the following statements are true or talse as argued by Legović and Geček…
A: 1) yes its a true statement , the biotic potential is defined as the maximum number of the offspring…
Q: Between the respiratory and urinary systems, which would you say is easier to achieve homeostasis
A: Homeostasis is the condition of consistent internal, physical, and chemical circumstances kept up…
Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 100 to 10-7…
A: Original titer of Phage lysate = 3.7 * 104 cfu/mL A 100 dilution essentially means that the sample…
Q: An unusual correlation exists between the potency of an inhaled anesthetic and its ability to A)…
A: Answer :- Option (C) is correct. - expand and compress.
Q: Do the following mathematical calculations to figure out the work each hand did: Work = 1…
A: Introduction The relationship between two versions of a gene is referred to as dominant. Each parent…
Q: The following are words used in animal testing and its alternative methods. Define the following…
A: Vivisection: It is basically done as an experimental activity for study purpose. Here animals are…
Q: Jim hasn't been having success in growing strawberry plants for the past few years, so he got his…
A: The observation of the following experiment conducted by Jim is there is some problem with the soil…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: The Bax gene, codes for a cytosolic protein that plays an important role in apoptosis. Growth factor…
A: BAX gene is a pro apoptotic member of the BCL2 gene family. Correct statements are: - BAX gene is a…
Q: In most populations, population size remain near the carrying capacity as long as limiting factors…
A: Limiting resources are considered as the carrying capacity for any population.
Q: Identify if the following statements are true or false. Quantitative PCR is also known as the…
A: A real-time polymerase chain reaction is a molecular genetics lab technology that involves the…
Q: The proteins work together to cause the release of the transcription factor that is bound by the…
A: Answer is D p53
Q: A researcher studied 6 independently assorting genes in a plant. Each gene has a dominant and a…
A: Given: Dominant allele Recessive allele R- Black stem r- red stem D- tall plant d- dwarf…
Q: Bradley did two test PCR experiments with his phage genomic DNA. For one experiment he used G…
A: For categorizing phages, the term 'clusters' is used for groups of similar phages. It aids in…
Q: Question z Methanogens are always engaged in relationships with other microbes because methane…
A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…
Q: What is corpus luteum. How does it function as an endocrine gland?.
A: Introduction :- During the ovulatory phase, when an ovarian follicle releases an egg, the opened…
Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…
A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…
Q: What function do the malleus, incus, and stapes bones in the inner ear play in processing sounds?…
A: The malleus, incus, and stapes bones also known as auditory ossicles . Present in the Inner ear .…
Q: Do you think that Leo needs to drink more water prior to his exercise? Explain why?
A: Dialysis is a technique to eliminate byproducts and excess liquid from the blood when the kidneys…
Q: Name and describe the main fuctional macromolecule found in red blood cells
A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…
Q: 1. What might be a disadvantage to temperature-dependent sex determination?
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: What would happen to a person whose body did not produce bile ?
A: Bile is the fluid which is synthesized and secreted by liver and stored in the gallbladder. Main…
Q: What are the principle and basic concepts of GRAM STAIN?
A: Gram staining is among the most important microbiology staining procedures. It was first invented in…
Q: Stem height in Wisconsin Fast Plants is a polygenic trait controlled by 6 genes. In a cross between…
A: Let us assume the 6 genes that control the stem height in Wisconsin Fast plants to be A, B, C, D, E…
Q: Question 25 Which of the following RNAS is the product of transcription? A MRNA and tRNA only B FRNA…
A: Answer: D) mRNA, tRNA and rRNA. The product of DNA transcription is RNA it can be in the form of…
Q: Briefly explain the following concepts in relation to delivery and assessment strategies, for each…
A: The qualifications and related units of competency that need to be completed customise for each…
Q: You are studying a pathogenic bacterium which secretes a toxin that affects G protein receptor…
A: The cAMP signaling pathway, commonly referred to as the adenylyl cyclase pathway, is a cell…
Q: How are ACE1 and ACE2 receptors related to the structure and function of mRNA vaccines (Moderna &…
A: ACE1 and ACE2 receptors aka angiotensin converting enzyme-2/ enzyme 1 plays an important role and…
Q: 898/quizzes/4239/4/take Which of the following things is/are true about this organism? unicellular…
A: Kingdom fungi of the biological world comprises of eukaryotic, multicellular, non chlorophyllus,…
Q: Choose 1 biotechnology product in the field of agriculture. Provide a 1-3 minute monologue about…
A: Biotechnology is a branch of technology that is based on biology. The use of living systems and…
Q: Urinary system lab assignment and related case study Leo, 37-years old was absolutely shocked when…
A: Introduction The kidneys, ureters, bladder, and urethra make up the urinary system, often known as…
Q: Choose 1 biotechnology product in the field of medicine or agriculture. Provide a 1-3 minute…
A: Biotechnology is a branch of science concerned with the use of biological methods for the benefit of…
Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…
A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…
Q: Essay on Circulatory system
A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system, which…
Q: Explain the figures below in detail, this is about baroreceptors Baroreflex Disturbance Response 1.0…
A: Baroreceptors They are mechanoreceptors found in blood arteries around the heart that detect the…
Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Q: A dominant allele that arises from recurrent mutation is mildly deleterious. The fitness of…
A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of errors in…
Q: happens when traits become more common in a population because of the reproductive success of…
A: Mechanical isolation is defined as the physical incompatibility between the reproductive organs of…
Q: Organisms with favorable characteristics are more likely to survive and pass on their traits to…
A: Variation means genetic differenced between cells, individual organisms or group of organisms.…
Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…
A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…
Step by step
Solved in 2 steps with 1 images
- In lab we learned a technique that helped us to visulize individual colonies of bacter 1. Describe this technique. 2. What do you expect the resutls to look like? Be specific. 3. How can this technique help you to determine if your culture is contaminated? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph I +] F H Ix X ABC † ( O K₂ KN Q V Arial sè "Ω Θ A 4 10pt EE 88 A Click Save and Submit to save and submit. Click Save All Answers to save all answers. 描く前 X² X₂ 3 由用目In Figure 5-5,a. Why do A− and B− cells, by themselves, not formcolonies on the plating medium?b. What genetic event do the purple colonies in themiddle plate represent?Antibiotic Zone of Inhibition A 15 mm B O mm 7 mm 15 mm a. Which antibiotic was most effective against the bacteria being tested? b. Which antibiotic would you recommend for treating a disease caused by this bacterium? c. Was antibiotic A bactericidal or bacteriostatic? How can you tell?
- Iryour igation and transformation reactions were successful, what will you see on the LB/AMP/X-gal/IPTC agar plate? OWhite growth O Blue growth O No growthA.Why do you plate the cells from the viable count on LB agar without ampicillin? B.If you observe 100 colonies on your 1/100 plate, how many colonies do you expect if everything works perfectly on your 1/1000 plate?Pipetting 1. Explain why a micropipettor is an important instrument in biochemistry labs. 2. Describe the basic components (and function) of a micropipettor. Bacterial Techniques 1. Define the following. (a) Serial Dilution (b) Streak Plating (c) Spread Plating Transformation 1. Define bacterial transformation and explain why it is an important method in biochemistry labs. 2. Describe (figure, narrative) a plasmid and describe the basic components of a plasmid. 3. What role does CaCl2 play in bacterial transformation? 4. What role does heat shock play in bacterial transformation? Plasmid Isolation 1. Describe the roles the following play in plasmid purification. (a) Lysis Buffer (b) Neutralization Buffer (c) Elution Buffer
- in lab: . cath sample + antibiotic susceptible A. baumanii _occurrence of conjugation and colonies seen ( WHITE) question: Why was there growth in sample (a) listed above?A B Which of the bacterial colonies shown (A or B) was nonlethal when injected in mice? А ВArial BIUA 11 + .. | I 1 I 3 I 4 i.) Fill in the table for each of the E. coli: (0) = No Activity (+) = Basal Activity and (+++) = High Activity E. coli chromosome F' Plasmid B-gal activity? Permease activity? When When When When Glucose is Lactose is Glucose is Lactose is present present present present a.) I+ P+ O+ Z+ Y+ Inone +++ +++ b.) I^[S] P+ O+ Z+ Y+ none c.) I+ P+ O^[c] Z+ Y+ none d.) I+ P+ O- Z- Y+ none e.) I+ P+ O+ Z+ Y+ I^[S] P+ O+ Z+ Y+ f.) I^[S] P+ O+ Z- Y+ I+ P+ O^[c] Z+ Y- g.) I^[TB] P+ O+ Z+ Y 1+ P+ O^[c] Z- Y+ h.) I+ P+ O^[c] Z+ Y- I+ P+ O+ Z** Y+ i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+ Z** is a polar mutation ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of ß-galactosidase protein activity with and without lactose present, why? MacBook Air 000
- PART C (cont'd) Which of the following steps (on this page and the next page) would be necessary to determine the most effective antibiotic for a bacterial infection using the Disk Diffusion Assay? Select three necessary steps and three unnecessary or incorrect steps, and explain why it is or is not necessarv/correct. Collect a sample of bacteria from the infected patient. Collect samples of bacteria from the bathroom taps in the patient's room. Collect samples of bacteria from other patients who seem to have the same infection. Soak disks in many different types of antibiotic. Soak disks in the antibiotic you have the biggest supply ot. Label the disks with the type of antibiotic you soaked them in.PART C (cont'd) Which of the following steps (on this page and the next page) would be necessary to determine the most effective antibiotic for a bacterial infection using the Disk Diffusion Assay? Select three necessary steps and three unnecessary or incorrect steps, and explain why it is or is not necessarv/correct. Collect a sample of bacteria from the infected patient. Collect samples of bacteria from the bathroom taps in the patient's room. Collect samples of bacteria from other patients who seem to have the same infection. Soak disks in many different types of antibiotic. Soak disks in the antibiotic you have the biggest supply ot. Label the disks with the type of antibiotic you soaked them in. • Leave the petri dishes uncovered while the bacteria grow. , cover the petri dishes while the bacteria grow. Treat the bacterial culture with a disinfectant before spreading on the agar plate Wear personal protective equipment (gloves, mask, lab coat) while performing the procedure Wear…Immunology studying material. In cases of possible Infectious Mononucleosis, both Heterophile Antibody testing and EBV Antibody testing may be performed. Interpret the following sets of results below as one of the following: No history of EBV suggested Current or Recent EBV suggested Past EBV suggested Format example, Letter A “Current or Recent EBV suggested" A. Positive Heterophile Slide Test only (No EBV testing performed): B. Positive Heterophile Slide Test, Positive EBV VCA IgM & IgG: C. Negative Heterophile Slide Test, Positive EBV VCA IgM & IgG: D. Negative Heterophile Slide Test, negative EBV VCA IgM & IgG & EBNA: E. Negative Heterophile Slide Test, negative EBV VCA IgM, positive IgG, Positive EBNA: