Q: What is the mathematical expression for the genetic equilibrium for genes with two alleles? Is this ...
A: Hardy Weinberg equation is used to calculate genetic variation of a population at equilibrium. Hardy...
Q: 1. Will the water penetrate all through the sandwich? Explain. 2. Explain which layer(s) of the san...
A: The sandwich or lipo-protein sandwich model explained that cell membranes contain both proteins and ...
Q: BMI: 24.6 Energy Needs: 1,850 Is this energy consumption and energy expenditure balance? ...
A: The BMI was introduced in 19th century. He produced the formula to give a quick and easy way to meas...
Q: Describe Rhizopus oligosporus and Penicillium sp.
A: Kingdom Fungi Fungi are filamentous and the body consists of long slender thread like structures ca...
Q: Meiosis: Events Put the letter of each meiotic stage next to the correct event. Use each answer choi...
A: Meiosis is a sort of cell division that redices the quantity of chromosomes in the parent cell by ha...
Q: What molecular biology principle is the basis for DNA fingerprinting?
A: In this question we will discuss about the molecular biology principle basis of the DNA fingerprinti...
Q: How is the early diagnosis of genetic diseases usually done?
A: Introduction The diagnosis of genetic diseases can be made during the prenatal period, either throug...
Q: Examine the factors that caused speciation.
A: Speciation is the process by which different species emerges through evolution. A species is a colle...
Q: Velocity of action potential is slower in myelinated than in unmyelinated.
A: A. Velocity of the action potential is slower in myelinated sheath than in ummyelinated.
Q: Provide a diagram of vertebrate which exhibits isometric growth. Label the diagram showing the areas...
A: What is Isometric Growth? Isometric development alludes to the equivalent development of all body pa...
Q: 56- Which of the following is correct regarding decerebrate rigidity:
A: Decerebrate rigidity :- it is also known as extensor posturing.
Q: How is genetic engineering used to create bacteria capable of producing human insulin?
A: Introduction When bacteria produce human insulin, the human insulin gene is incorporated into the ge...
Q: Which of the following could you obtain from PLANT foods but not from animal foods? fiber O carbohyd...
A: Introduction :- Fibre is found in plant foods such as vegetables, fruits, grains, beans, and legumes...
Q: Question 1 (1) Cells are highly complex and organized. (2) Cells are capable of producing more of th...
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to answe...
Q: What is the implication that sperm cells have a lot of mitochondria and not much other organelles?
A: Mitochondria It is a double membrane bound organelle found in cytoplasm of eukaryotic cells. They p...
Q: Expression of ---- does not require new protein synthesis. a.immediate early genes b. delayed ea...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: One of the following diffusion paths is not driven by the concentration of sub: a- Primary active tr...
A: Active transport uses energy for the transport of solute, whereas passive diffusion and simple diffu...
Q: How does Genetic Engineering helps the problem of medicine ?
A: Introduction :- Genetic engineering is the process of altering an organism's genetic makeup using re...
Q: Find and match the scientific names of the organisms’ common names using the following key (picture ...
A: Scientific names of these organisms using the key are given below
Q: Question 5 (1) Phosphate + ribose is a nucleotide (2) Tertiary structure in DNA is also known as dou...
A: Structure of DNA , nucleotides, nucleosides. DNA is a polymer of nucleotides called as a polynucleot...
Q: 5- The hydrolysis of ATP is achieved to transport certain sub, this is called: a- Secondary transpor...
A: Introduction :- ATP, or adenosine triphosphate, is a chemical that transports energy within cells. I...
Q: Read the list of vestigial structures found in humans. Then hypothesize a possible function for each...
A: A rudimentary structure in humans that have no apparent function and appear to be residual parts fro...
Q: n EMPEROR-Reduced study in jardiance, _______ treated patients with HFrEF were 65 years of age and o...
A: Heart failure with reduced ejection fraction (HFrEF) is a systolic heart failure caused by impaired ...
Q: Hi! The image is there as reference. GIve other examples of homologous structures.
A: Homologous structures are the organs / structures that have similar appearance means their structure...
Q: Describe the spinal cord according to: A. location B. shape and length C. vertebral levels of upp...
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby guidelin...
Q: 17. NF1 protein ---- Ras signaling. a. activates b. inhibits 18. The deacetylation of the histones r...
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to answ...
Q: 7. Circle the correct answers to complete the sentences: For a successful transfusion, the patient m...
A: Introduction :- Antibodies are specialised, Y-shaped proteins that bind to foreign invaders in the...
Q: Why is extra primers added to the pcr reaction?
A: Introduction :- The polymerase chain reaction, or PCR, is a chemical reaction used by molecular biol...
Q: 1- One of the following diffusion paths is not driven by the concentration of sub: a- Primary active...
A: Introduction: Passive transport is a movement of biochemicals and other atomic or molecular substanc...
Q: 5 RIM Habitat Isolation ,Temporal Isolation , Behavioral Isolation , Mechanical Isolation , Genetic...
A: The organisms of similar species are isolated and this happens when there is something between the l...
Q: Photosyntheis related question (s): When protons move out of the thylakoid, are they moving up or d...
A: The photosynthesis involves production of simple carbohydrates (glucose) from the carbon dioxide and...
Q: . You have identified a mutation in yeast, a unicellular eukaryote, that prevents the capping of the...
A: Central dogma states the conversion of DNA into mRNA via transcription and mRNA into proteins by tra...
Q: ture or false The CO2 rebreathing method for measuring cardiac output can be used with strenuou...
A: *CO2 rebreathing method is used to measure the cardiac output. *Cardiac output by this method is bas...
Q: Why and nucleus transplantation technology still dangerous? are recombinant DNA technology
A: Recombinant DNA technology is joining together of DNA molecules from two different species. The rec...
Q: Are axons more likely to regrow in the peripheral nervous system or the central nervous system? Why?
A: CNS stands for Central nervous system. Here, the axons do not have the ability to spontaneously rege...
Q: is the protein produced by S. aureus that causes od to release attractants. PLV kills which release ...
A: surface proteins that are covalently attached to peptidoglycan, which are known as cell wall-anchore...
Q: Why are recombinant DNA technology and nucleus transplantation technology still dangerous?
A: There are few points about recombinant DNA technology and nucleus transplantation technology . These...
Q: What do you think will happen to the accumulated lead metals of the plants after a successful phytor...
A: Phyto remediation is the process by which plants are used to removes pollutants in the soil. The pla...
Q: Describe the three body forms typical of animals
A: The animals can be classified based on their body symmetry, these are: Bilateral symmetry Radial sy...
Q: 3- a muscle contracts more forcefully if: a- its motor units contracted simultaneously. b- the amoun...
A: Muscle contraction is regulated through the the function of alpha motor neuron/lower motor neurone w...
Q: What information can be obtained from the slides prepared by wet mount and hanging drop technique fo...
A: A wet mount is produced by putting a fluid solution on a slide, suspending a specimen in it, and the...
Q: Describe why primitive animals are primarily marine
A: The first life on Earth was observed in water, billions of years ago. Primitive organisms are the sm...
Q: What are the other three different types of microtome (except hand microtome). Describe and differen...
A: Microtome is an instrument which is used to thin , fine and uniform sections of specimen for the pu...
Q: Noncompetitive inhibition can often be explained by which of the following models? the induced fit m...
A: The action of enzyme depends on different factors. Enzymes are biocatalysts in nature. All the react...
Q: True or false? Inbreeding can increase the frequency ofa harmful allele in a population’s gene pool
A: Inbreeding is a process in which two closely related organisms which are related through common ance...
Q: 4. Put the following steps of the ELISA assay in order (Write the numbers 1-4 in the blank): Add Ant...
A: Introduction: ELISA stands for Enzyme Linked Immunosorbent Assay. It is a commonly used laboratory t...
Q: 55- For antigravity muscles, firing the medulla leads to: A. Decerebrate Rigidity C. Excitation the ...
A: Antigravity muscles: As the name suggests these oppose the direction of gravity. These muscles are w...
Q: Describe the method of seed dispersal of the fruit & seeds in the picture below. The more detailed y...
A: Maple seeds travel on the wind by using their wings, but they also attract animals as they are tasty...
Q: QUESTION 1 Match each term with its correct description +Anatomical sex A. A persons sense of themse...
A: The correct matches are written before each terms in below table.
Q: why is a cell unable to respond to epinephrine signaling
A: * common goal of signalling pathways is to to produce cellular response, a signal is released by the...
Step by step
Solved in 2 steps
- Which of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the aboveIn one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of DNA polymerase III =Match each DNA Replication enzymes on the left with its function I) DNA Ligase II) DNA Polymerase II III) DNA Polymerase I IV) DNA Helicase V) Primase VI) DNA Polymerase III Proof reads DNA after replication and checks for mistakes Breaks hydrogen bonds holding adjacent base pairs together Synthesizes complimentary strands of DNA during DNA replication Builds RNA primers Removes RNA primers and replaces them with DNA nucleotides during replication Joins adjacent DNA nucleotides to each other
- A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide LengthThe following statements are correct EXCEPT: A) Information in the DNA is transcribed int mRNA and translated into proteins B) Information in the DNA is translated int mRNA and transcribed into proteins C) Information in the DNA is copied by DNA polymerase D) The lagging strand during DNA replication is synthesized continuously to form the okazaki fragments E) B and DIdentify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.
- Which statement about Okazaki fragments is true? Select one: a. DNA polymerase doesn’t need a primer to build these fragments b. They act as a primer that initiates DNA replication. c. They correct errors made during earlier phases of DNA replication. d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork. e. They prevent the ends of chromosomes from shortening with every replication.Match the enzyme or protein to the replication process. Record your answers onto the Google Form. a. DNA polymerase I b. DNA polymerase I| c. DNA polymerase III d. primase e. DNA ligase f. helicase 9. single-strand-binding proteins h. topoisomerase II 58. Unwinds helix and breaks hydrogen bonds to make a replication fork. 69. Removes RNA primer and replaces it with DNA nucleotides. 60. Joins together the fragments made on the lagging strand. 61. Adds a short segment of RNA to start replication. 62. Stabilizes newly unwound strands. 63. Catalyzes the addition of new nucleotides, one at a time. 64. Relieves strain of over winding created by replication fork. 65. Proofreads new nucleotide sequence for correctness.Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?
- The figure below depicts various elements of the eukaryotic replication machinery in action. Enter the name for the protein depicted by each box. Box A Box B Box C Box D Box E Box F DNA polymerase on lagging strand (just finishing an Okazaki fragment) F Maintains polymerase association with DNA Enzyme extends separation of DNA strands Synthesizes RNA fragments that hybridize to DNA Relaxes supercoiled DNA ahead of replication fork Maintains DNA is single stranded state Promotes binding of processivity factors to DNA Newly synthesized strand pocoar Leading-strand template A New Okazaki fragment RNA primer E Lagging-strand template DNA polymerase on leading strand B C D Saaragon - Next Okazaki fragment will start here Parental DNA helixdetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acids 5. the discussion of the entire procedureThe region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’