Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table.
Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…
A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein
A: Sequence of nucleotide in mRNA AUGCGUUCAUGGACU is given .
Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…
A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…
A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: If an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAG
A: During translation the ribosome traverses over the mRNA in order to produce a peptide chain with the…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…
A:
Q: What happens when a stop codon is reached by a ribosome? A termination tRNAter binds to the codon…
A: The protein synthesis process is known as translation. The protein synthesis occurs in the cytoplasm…
Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…
A: With the help of translation process protein forms. The nucleotide sequence are translated into…
Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…
A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…
Q: Which codon codes for the C-terminal residue in the polypeptide structure shown below? H3N 'N' NH3 H
A: GENETIC CODE is the relation between the base sequence of a gene and the amino acid sequence of the…
Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…
A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…
Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…
A: CODON- It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.
Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…
Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…
A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…
Q: In the genetic code, one codon a. consists of three bases. b. specifies a single amino acid.…
A: Answer is d.) both a and b are correct.
Q: A codon consists of _ bases and specifies which will be inserted into the polypeptide chain. 4,…
A: The codon defines the relationship between a nitrogenous base sequence and the corresponding…
Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…
A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…
Q: ribe the crucial role of base pairing between codon and anticodon.
A: The hereditary material translated into messenger RNA is expressed by the triplet code (mRNA). The…
Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: Choose whether the statement is TRUE or FALSE "There are no aminoacyl-tRNAs that will go to the A…
A: Protein synthesis ends when one of the 3 stop codons :-: UAG (amber) UAA (orchre) UGA(opal) Enters…
Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…
A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…
Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…
A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…
Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code…
A: 4) tryptophan- UGG 5) Leucine- CUU, CUC, CUA, CUG
Q: After the ribosome slides along the mRNA, the dipeptide will be attached to the tRNA in the ________…
A: The RNA molecule transition ribonucleic acid (tRNA) assists in the translation of a messenger RNA…
Q: The found in the MRNA is complementary to the found in the TRNA. O anticodon, anticodon O anticodon,…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…
A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…
Q: Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2.…
A: Ribosomes are responsible for the production of proteins. They accomplish this through a process…
Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: Create protein sequence with 10 elements. (Start with a codon and ends with a stop codon)
A: Protein sequencing is the cycle of deciding the amino acid arrangement of all or part of a protein…
Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…
A: Codon are the triple of a base pair.
Q: A scientist while sequencing mrna identifies the following strand…
A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…
Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…
A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…
Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: start codon and stop codon
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: The genetic code is Random in that the codons for the same amino acid are structurally unrelated…
A: Genetic code contains information that can be used by certain organelles to translate information…
Q: Write a short tutorial (short) on how to use the mRNA codon table. In your tutorial explain the…
A: The genetic code refers to the entire collection of interactions between codons and amino acids (or…
Q: the DNA triplet is TTA, then the transcribed mRNA codon would be
A: There are four nucleotides from which DNA and m RNA are made- Adenine -A Thymine- T/ U- uracil…
Q: sequence of the anticodon that recognizes the codon AAG
A: Central dogma is the flow of information from DNA to RNA to protein. During this protein synthesis a…
Q: during translation, each codon on the mRNA complementary base pairs with an snticodon on.....
A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 8 images
- A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionA single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'List two possible missense mutation effects on the new polypeptide.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
- A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wild-type composition...lys-ser-pro-ser-leu-asn-ala-ala-lys....to the lys-val-his-his-leu-met-ala-ala-lys. a. Decipher the segment of MRNA for both the original protein and the double mutant. mutant form b. Which base was added? Which was deleted?Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-ArgWhat is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
- 5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-GlyA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through c. For Mutant 1: Met-Ser-Pro 1) indicate what change has occurred at the DNA leve! 2) identify the specific type of mutation that occurred in the DNA (single base substitution, frameshift (insertion, deletion), 3) indicate the phenotypic effect of the mutation (nonsense, etc.). Show all work.