Describe the diagnostic procedure or procedures (molecular or immunologic) that would be appropriate for: Presence of Histoplasma fungal antigens in a patient’s serum
Q: in 1995, a population of 31 gray wolves was introduced into Yellowstone National Park. The…
A: Some species live in unique climatic conditions since every living thing developed to exist in a…
Q: A group of birds colonize an island. Over time, they become different from the mainland source…
A: A group of birds colonize an island. Over time, they become different from the mainland source…
Q: Another name for a normal gene is: Select one: O a. dominant. O b. wild-type. O c. pleiotropy. O d.…
A: A trait is a characteristic feature that is unique to particular individual. Each trait is…
Q: Explain how the exon/intron structure of genes contributes to the generation of new gene functions…
A: The genetic coding for the triplets contains the genes. The information encoded within the genetic…
Q: H.W: Normal value of Intensity of bone, soft tissue, fat, air, metal (stainless steel, titanium…
A: Radiographic density or X-ray density is a measure of degree of film darkening. It is the measure of…
Q: Genome sequences show that some pathogenic bacteria contain virulence genes that promote disease…
A: Lateral gene transfer (also called horizontal gene transfer) has played an important role in…
Q: This type of lymphocyte contains CD4 receptor sites used by the HIV virus. All of the above Helper…
A: Cd4 is a glycoprotein that serves as a co-receptor for the T-cell receptor. CD4 is found on the…
Q: Why do scientists think that all forms of life on earth have a common origin?
A: Darwin's theory of common descent is that all species of life have descended from a common ancestor.…
Q: Identify this organism by it’s genius name
A: Volvox is a genus of green algae that form spherical colonies composed of 2,000 to 40,000 individual…
Q: After a heavy meal Jane was strolling the streets of She came across bakery, and she could smell…
A: Introduction Smell is one of the important senses of the five senses of our body. The olfactory…
Q: (common namel
A: The kingdom Plantae contains eukaryotes that mostly performs photosynthesis. Algae and fungi were…
Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…
A: Transcription and translation are terms used to describe two distinct biological processes: the…
Q: The presence of charged residues in proteins contributes to charge-charge interactions which in turn…
A: The charge-charge interaction is the force that exists between two charged particles. This force is…
Q: RNA shares with proteins the ability to fold into complex three-dimensional shapes. As a result, RNA…
A: DNA (deoxyribonucleic acid) and proteins are arranged into chromosomes, which control how DNA is…
Q: Explain activation-induced deaminase (AID) induced mutation in the DNA arose by deamination of…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by transcription process…
Q: The reason why lions do not develop scurvy without eating vegetable is that lions eat herbivore…
A: Scurvy is a disease carried on by a lack of vitamin C. (ascorbic acid). Early indications of a…
Q: Intermediate filaments (IFs) function to provide mechanical strength to the cell and for internal…
A: Intermediate filaments (IF) are essential to the cytoskeleton network, but they are not present in…
Q: what is Taxol ? What does it Target in cancer cells ? (relate it to cell communication and cell…
A: Introduction : The term "cancer" refers to disorders in which abnormal cells proliferate…
Q: Different mutations in the WDR62 gene that inactivate gene function were found in the genomes of…
A: Introduction: A neurological condition known as microcephaly is brought on by a mutation, or altered…
Q: Sporangium
A: Reproduction is the process by which new organisms are produced by the existing ones. It is required…
Q: 53. Which of the following is a genetic disorder caused by a mutation in only a single nucleotide…
A: Sickle cell anemia - It is a genetic disorder that causes red blood cells to become sickle shaped…
Q: Fungi have a stage of the lifecycle, not seen in other organisms, known as the what stage
A: Ans: Fungi is just like other microorganisms molds and bacteria have chitin in the cell wall. It is…
Q: Piebald spotting is a condition found in humans in which there are patches of skin that lack…
A: A person's physical and physiological features are all passed down to them through their genes,…
Q: 7. DNA generally forms a double stranded helix. If a single stranded DNA has a nucleotide sequence…
A: A DNA has two strands and each strand composed of 4 types of nucleotides (adenine, guanine, cytosine…
Q: why aglaonema "big roy" mutasi has a color combination of greens, orange and pinkish.
A: Every plant has pigments present. If the pigments are few in number then the colours will be…
Q: Y-linked 이마 In the pedigree shown, indicate whether each of the following inheritance patterns is…
A: Autosomal dominant are effected parent in l generation. Y linked traits are related
Q: How is it possible for a bacterium to grow in a hypertonic environment?
A: Microbiology is the science of microbes. Microorganisms aid in the creation of various foods, the…
Q: Fungi tend to reproduce sexually when nutrients are limited or other conditions are unfavorable, but…
A: Fungi are saprophytic organisms with a cell wall and no chlorophyll. Hence they are been considered…
Q: 7.) Give the base sequence of the complementary strand of DNA in this molecule. Label the 5' and 3'…
A: DNA is also called as Deoxyribonucleic acid which is an polymer composed of two polynucleotide…
Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
A: The initial stage of gene expression, transcription, uses information from a gene to build a…
Q: Why is erythropoietin a popular drug among athletes? Explain with the physiological mechanism. BIUG…
A: The primary hormone controlling red blood cell (RBC) formation is erythropoietin (EPO). Recombinant…
Q: Why is untreated pyelonephritis dangerous?
A: Pyelonephritis is an infection of the kidneys. The word may be broken down to Pylos + Nephros +…
Q: Name the reproductive and non-reproductive parts of bread mould (Rhizopus).
A: A particular kind of fungus called bread mould can develop on bread. Tiny spores that are the mould…
Q: Rarely, both sister chromatids of a replicated chromosome end up in one daughter cell. How might…
A: Mitosis is a cell division in which one mother cell will divides into two new daughter cells which…
Q: If I take a sample of a person's white blood cells, 60% to 70% of them will be the "first responder"…
A: White blood cells or WBC are responsible for performing immunological activities within the body and…
Q: If you were to design an own bacterial/archaeal species, what would be its characteristics (e.g.…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: Draw and analysis of DNA replication at one replication fork. Show how the leading and lagging…
A: Replication is a fundamental molecular process by which daughter DNA are synthesized from the…
Q: Name the reproductive and non-reproductive parts of bread mould (Rhizopus).
A: Bread mould is a type of fungus that can grow on bread. The mould is made up of tiny spores that…
Q: reflective ward be green II. Extract chlorophyll from geranium leaves by boiling in ethanol until…
A: Chlorophyll The green pigment found in plants is called . It aids in the production of starch…
Q: Citrus × microcarpa
A: citrus × microcarpa, commonly known as calamondin or orange calamondin is a small , bushy, evergreen…
Q: Draw a diagram/flowchart and describe in detail the process of normal clot formation AND breakdown,…
A: The understanding of the blood coagulation system has advanced recently in anesthetic practice.…
Q: I. A. Photosynthesis Review 1. Where (in the Z-scheme) is O2 generated? How? Why? 2. What molecule…
A: Z scheme has become the basis for understanding oxygen evolving photosynthetic organisms. It…
Q: When species arise as a result of changes in chromosome number that make them incompatible with the…
A: A group of people who regularly interbreed in nature is referred to as a species. A species is the…
Q: Future Uses of Citric Acid in Biotechnology
A: As defined by the National Institutes of Health, biotechnology is a broad field of biology that…
Q: Drag and drop each item to the correct form of absorption. Movement is down the concentration…
A: Passive adsorption is the one that does not require energy source whereas the active one does…
Q: what molecular complex serves as a recognition. factor for premature stop codons? exon-junction…
A: Codons are the combinations of three nucleotides and specify the amino acids during the process of…
Q: P is a dominant allele for pu following cross is performed flowers? In peas, T (tall) is dominant…
A: In a genetic cross, two different individuals are crossed or mated to produce off-springs that…
Q: Fill in the type of research methods in the following questions. A total of 100 patients with…
A: Research methods These are the methods, procedures, or methods used in the gathering of information…
Q: 34. Which of the following best describes the epithelium in the histologic section shown? A)…
A: INTRODUCTION:- A tissue is a group of one or more types of physically linked cells…
Q: Describe the structure of the cell membrane using the terms ‘phospholipid bilayer’ and ‘fluid mosaic…
A:
Describe the diagnostic procedure or procedures (molecular or immunologic) that would be appropriate for:
Presence of Histoplasma fungal antigens in a patient’s serum
Step by step
Solved in 2 steps
- Describe the diagnostic procedure or procedures (molecular or immunologic) that would be appropriate for: Detection of human papillomavirus 16 (a nonreplicating virus) in a Papanicolaou (Pap) smearList three (3) signs that could indicate that a client could have a possible infection.Which link in the chain of infection is the intervention described below meant to break? "Clean and disinfect high-touch surfaces daily in household common areas (e.g. tables, hard-backed chairs, doorknobs, light switches, phones, tablets, touch screens, remote controls, keyboards, handles, desks, toilets, sinks) In the bedroom/bathroom dedicated for an ill person: consider reducing cleaning frequency to as-needed (e.g., soiled items and surfaces) to avoid unnecessary contact with the ill person.!" (https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting- sick/cleaning-disinfection.html) Means of transmission Portal of entry O Infectious agent O Susceptible host
- Discuss how a pathogen causes an infection. Include definitions for primary pathogen, opportunistic pathogen, infection, disease (caused by a living organism), and various stages of pathogenesis. You can choose a specific organism to describe (like Orthomyxovirus and Influenza) or discuss a generalized infection.A nurse is caring for a patient who is receiving intravenous (IV) therapy. Which action is essential for preventing infection? a) Changing the IV tubing every 24 hours b) Using sterile technique during IV insertion c) Monitoring the IV site for signs of infection d) Administering IV medications as prescribedVariolation means: Infecting patients with one disease, like smallpox, in order to prevent a more severe disease, like cowpox Infecting patients with one disease, like cowpox, in order to prevent a more severe disease, like smallpox • Deliberately exposing children to dead patients • Deliberately exposing children to infected cows Infecting patients with the causative agent of a mild case of the disease, in hopes of preventing a severe case of the disease
- Describe each of the following infections using correct technicalterminology. (Descriptions may fit more than one category.) Useterms such as primary, secondary, nosocomial, STD, mixed, latent,toxemia, chronic, zoonotic, asymptomatic, local, systemic, -itis, -emia.Caused by needlestick in dental officePneumocystis pneumonia in AIDS patientBubonic plague from rat flea biteDiphtheriaUndiagnosed chlamydiosisAcute necrotizing gingivitisSyphilis of long durationLarge numbers of gram-negative rods in the bloodA boil on the back of the neckAn inflammation of the meningesSleeping sickness (African trypanosomiasis) Mode of Transmission: Hallmark of Infection: Drug of Choice: American trypanosomiasis (Chagas disease) Mode of Transmission: Hallmark of Infection: Drug of Choice:what infections are determined / diagnosed by this procedure. Discuss the infection as to etiologic agent, mode of transmission, symptoms, nursing care, treatment.
- Indicate whether the following sentences is either True or False and CORRECT if False : Exposure of Reovirus(non-enveloped) for short period of time to detergent can be applied to destroy this virus.Please write in table the pathogen ,their morphology, ecology, mode of -:transmissions, diseases, and their prevention methods , for : Mycoplasmas abd cell Wall-Defective BacteriaGive two disease caused by bacteria with definition, and briefly discuss the causative agent, transmission, signs and symptoms, portal of entry and exit, management (prevention and treatment).
