Q: All of the fossil remains of the early hominins and australopithecines are found on the continent of…
A: Introduction Human evolution:- It is the process by which human beings developed on Earth from…
Q: Thymus gland is important during early childhood in immune system development. Why is this so?…
A: Introduction Thymus gland:- It is a small organ that lies in the upper chest under the breastbone,…
Q: Would the relationship be the same if you had recorded the carotid pulse? Justify your answer.
A: Introduction The pulse rate, or the number of times the heart beats per minute, is a measurement of…
Q: is the study of the process of what happens to biological remains after an organism dies. This is…
A: Fossils are preserved remains of an organism that has been died in the past . The process of…
Q: Suggest key roles that mineralized bone might have played in early vertebrates.
A: Introduction :- A bone component called hydroxyapatite makes up nearly 70% of bone. The tissue is…
Q: Which embryonic germ layer lines the outer surface of the embryo
A: An embryo is the early stage of human development in which organs form critical body structures.
Q: Calculate for the calibration factor. (3 points) (Note: stage micrometer is 1 mm long with 100…
A:
Q: Experiment 1: An RT-PCR was run on human cells growing in tissue culture under standard conditions,…
A: PCR - Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing…
Q: Discuss the mechanical and chemical digestion of starch, protein, and fat, describing all the steps…
A: Introduction Digestion is the breakdown of large water-insoluble food molecules into small…
Q: Imagine you are a scientist observing rats in the wild. As the rats reproduce, rats born with white…
A: ANSWER:- One clarification is that white fur is a dominant trait, whereas black fur is recessive.AS…
Q: Describe or draw the process of creating a vesicle from an ER membrane OR fusing a vesicle with the…
A: A vesicle is a tiny cell structure made up of fluid and a lipid bilayer. Exocytosis, phagocytosis,…
Q: The diagram below shows the succession of communities from annual plants to hardwood trees in a…
A: The procedure of ecological succession suggests how the shape of an organic network (that is, an…
Q: Which statement is FALSE The kidney produces a concentrated urine by establishing a high…
A: The human body has different organ systems that perform different functions such as nutrition,…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Calico cats have tricolour coat. Their colouring is related to the X chromosome that's why they…
Q: Compare the male and female reproductive organs of reptiles and birds. Explain how are their…
A: Introduction Reptiles are cold-blooded animals that have vertebral columns at their backs. These…
Q: What is molecular basis of muscle fatigue?
A: Introduction :- Muscle fatigue is a sign that your muscles' ability to perform is deteriorating with…
Q: 1. In the pedigree below, Use "A" for the allele associated with the dominant phenotype, and…
A: A pedigree chart shows the inheritance pattern of a particular trait. Each row contains the…
Q: Test Ill- Encircle the word that should not belong to the group. 41. mushroom, yeast, bacteria, mold…
A: Spider is an arachnid, arachnids have eight legs.
Q: 19. Which of the following "range of phenotype" graphs best captures this story: a species of beetle…
A: The natural selection depends on the reproductive fitness of the individuals. Nature always select…
Q: Dominant trait: H (high metabolism) Recessive trait: h (normal metabolism) Possible Genotypes:…
A: Introduction "Genotype" refers to an organism's complete genetic information. The observed traits of…
Q: Which of the following statements is true regarding cell cycle regulators? a. Cyclins determine…
A: Cell cycle doesn't occur in unchecked manner. Cell preperation is usually checked by regulatory…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms, also known as flatworms, Platyhelminthes, or platyhelminths, are a phylum of bilaterian,…
Q: Citing data from the results table, tell which antibiotic is most effective against this type of…
A: Antibiotic zone of inhibition Antibiotics are a class of compounds or chemical that inhibits the…
Q: The "heart" of an insect, is located in the [blank] and is known more technically as the [blank]: a)…
A: An insect has mainly three parts; head, thorax, and abdomen. The insects have an open circulatory…
Q: Which of the following is not true of the lymphatic system? a. Oxygen is transported to body tissues…
A: Introduction The spleen, thymus, lymph, lymph nodes, and lymph vessels make up the lymphatic system.…
Q: RECOMBINATION". For numbers 7-35, reler to the given data below. Glven the following testcross data…
A: Introduction "Genotype" refers to an organism's complete genetic information. The observed…
Q: Q1/Answer the following: 1. Describe the digestion of proteins by pancreatic enzymes? 2. Write the…
A: 1) Pancreatic proteases: Trypsin and chymotrypsin are endopeptidase type of enzymes. They…
Q: Describe at least two Cdk regulation check points during the cell cycle, Describe how that Step is…
A: cell cycle is a series of events that takes place in a cell as it grows and divides. A cell spends…
Q: What is the effect of the absence of the leaving group (acetomethoxy) at the position 3 and…
A: The presence of a leaving group at the 3'-position of a beta lactam antibiotic can lead to the…
Q: Compare the reproductive organs of reptiles and birds. How are their reproductive patterns…
A: The skin of the reptiles is covered by scales or Bony plates. Birds body are supplied with feathers…
Q: What made the pepper on water move upon the addition of the dishwashing liquid?
A: Water molecules are composed of two hydrogen molecules covalently bonded to one oxygen molecule.…
Q: 11. What is a typical characteristic of an r-selected species? a. boom-and-bust popuation growth…
A: The r/K selection hypothesis in ecology refers to the selection of features in an organism that…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: Briefly describe a generalized plant embryogenesis.
A: Plants are eukaryotic, multicellular organisms belonging to the kingdom Plantae and are capable of…
Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: Which of the following statement is most correct about fevers? CH Fevers are never dangerous. Just…
A: Fever is the temporary increase of body temperature of 98.6 degree F. It is the part of body's…
Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…
A: Rubisco stands for Ribulose Bisphosphate Carboxylase Oxygenase. It is the most abundant…
Q: To examine: Whether the statement "The oxygen consumed during the oxidation of glucose in animal…
A: The cell is the most fundamental structural and functional unit of life. It performs a variety of…
Q: To describe: The competitive and noncompetitive inhibitors and also describe the way in which they…
A: Inhibitors are molecules that prevent enzymes and substrates from binding together. Inhibitors work…
Q: Explain the amoeba process
A: The amoeba process is a method of cell division that results in the formation of two identical…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Introduction: The coat of calico cats is tricolour. They are females because their colouring is tied…
Q: What are B and T cells and how do they relate to lymph nodes? 2. What are cell-surface antigens? How…
A: Introduction:- The remarkable specificity of adaptive immune responses is due to lymphocytes.…
Q: While less known than Homo neanderthalensis, Homo_ _were recently discovered to have a recent last…
A: Ans... Homo floresiensis
Q: Alveoli are: small sacs where gas exchange takes place in the respiratory system surrounded by a net…
A: Introduction :- During the act of breathing in and out, the alveoli are where the lungs and blood…
Q: why are underground storage organs like onions, carrots, cassava, potatoes, etc high in carbs and…
A: Underground storage organs (USOs) are an important food source for many people around the world.…
Q: Compare and contrast the advantages and disadvantages of selective breeding versus genetic…
A: Genetic engineering or recombinant DNA technology is a process where we modify a particular gene of…
Q: Q16. How many differentially expressed genes can you identify using only 1 sample in each group and…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: The following table shows the number of dogs for certain tail lengths in a population of dogs. Tail…
A: A trait is a characteristic features that is unique to particular individual . A trait can follow :-…
Q: Based on this dietary profile, describe the possible disease that could happen to the fish stock and…
A: Amino acids Amino acids are the biomolecules that are joined together by peptide linkages to form…
Do it please
Step by step
Solved in 3 steps with 1 images
- Briefly describe the following properties of the Rab and Arf GTPases: a) Size, structure and cellular localization (for structure I want to know if they are lipidated and any other unique features) , b) How are they activated and inactivated (i.e. include the GEFs and GAPs), c). Give an example of downstream cellular effects.GTP binding proteins are molecular switches. How do GTP binding proteins work? Provide two examples of GTP binding proteins that function in intracellular protein transport. Make a drawing that illustrates the function of each of these proteins in their respective roles. Predict the direct outcome of a mutation that: Inhibits GTPase activity Inhibits interaction with the GEFUsing examples, describe the signalling pathway from receptor tyrosinekinase activation to gene transcription, highlighting key phosphorylationevents and domains involved
- Describe e-cadherins' ligand affinity properties. What is e-cadherins' role in cell sorting? Have detail.An SH2-containing protein contains a mutation that changes its binding pocket such that tyrosine and phosphotyrosine bind with equal affinity. As a result, MEK activity: does not change with receptor dimerization and transautophosphorylation decreases due to changes in Raf activation increases with ligand binding-induced dimerization decreases due to allosteric inhibition of SH2-domain bindingProvide three examples of some enzyme-coupled receptors bypass intracellular signaling cascades to regulate gene transcription.
- Explain the role/importance of the localization of GTPase-activating protein (Ran-GAP) in BOTH nuclear export and import. What would occur if there was a loss of function mutation in Ran-GAP? What would occur if Ran-GAP was localized in the nucleus?Explain the role/importance of the localization of GTPase-activating protein (Ran- GAP) in BOTH nuclear export and import. What would occur if there was a loss of function mutation in Ran-GAP? What would occur if Ran-GAP was localized in the nucleus?The oscillatory clock that drives somite forma-tion in vertebrates involves three essential componentsHer7 (an unstable repressor of its own synthesis), Delta (atransmembrane signaling molecule), and Notch (a trans-membrane receptor for Delta). Notch is bound by Delta onneighboring cells, activating the Notch signaling pathway,which then activates Her7 transcription. Normally, thissystem works flawlessly to create sharply defined somites(Figure Q21–2A). In the absence of Delta, however, onlythe first five somites form normally, and the rest are poorlydefined (Figure Q21–2B). If a pulse of Delta is suppliedlater, somite formation returns to normal in the regionswhere Delta was present (Figure Q21–2C). A diagram ofthe connections between the components of the clockand how they interact in adjacent cells is shown in FigureQ21–2D. In the absence of Delta, why do the cells becomeunsynchronized? What is it about the presence of Deltathat keeps adjacent cells oscillating in synchrony?