Depolarization of membrane to threshold potential [ [ Choose ] up to threshold potential at the initial segment Conduction of action potentials along the axon [ [ Choose ] Opening of voltage-gated na+ channels [ [ Choose ] > >
Q: The "Central Dogma of Life" states that the pattern of information that occurs most frequently in ou...
A: Central dogma is the process that occurs in the lifecycle of cell through which information present ...
Q: Identify the protozoan in each image an the structres marked. its mode of locomotion and mode of fee...
A: The protozoans belonging to kingdom Protista includes various range of unicellular organisms with va...
Q: Insects are attracted to the flower of plants. When they rub against parts of the plant, they carry ...
A: The transfer of pollen grains(carrier of male gamete) from anther to stigma is known as pollination....
Q: What complication could arise from the biological synthesis of ceramide?
A: * ceramides composed of sphingosine and fatty acid. * They are mainly present in cell membranes with...
Q: Use the diagram below to answer Questions #2-4. 2. Draw arrows between the organisms to show how ene...
A:
Q: Match the lung disease with its correct description + Pulmonary Edema A. Alveoli become thickened an...
A: •Pulmonary Edema:- B.Fluid accumulates in the space between the alveoli and alveolar capillaries, im...
Q: The range of tolerance for catfish 40 35 30 25 - Temperature in degrees Celsius 20 - The number of c...
A: Von Liebig's Law of the Minimum states that yield is proportional to the amount of the most limiting...
Q: 1. The two major reasons that a cell undergoes mitosis is: and 2. a. What is one major difference be...
A: Mitosis is the cellular division that forms two daughter cells. These cells are identical to the mot...
Q: Hello good day, I hope today has been kind to you. So I am having a problem answering this question ...
A: Introduction :- Protozoa are single-celled organisms that can be found in almost every ecosystem on ...
Q: Fill in the blanks in each sentence below after re-reading the section on Osmosis and Tonicity. Osmo...
A: Introduction :- The spontaneous net movement or diffusion of solvent molecules through a selectively...
Q: Which of the following is considered beneficial to our health and recommended to consume more? 1. Sa...
A: Cholesterol is a lipid organic molecule and is one of the components of cell membranes. Cholesterol ...
Q: What are some new, simple, and unique transgenic organism in today’s time that can be useful
A: In animals, kingdom different phylum is present like Chordata, Hemichordata, Echinodermata, Mollusca...
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Required information 1Ab:1a B More A b and a B; and fewer A B and a b 1AB:1ab 1AB:1Ab:1 a B:1 ab Mor...
A:
Q: Please match the term with the description. the anterior end of a tapeworm that attaches to the insi...
A: Answers are in chronological order, 1 - Scolex 2 - Diploblastic 3 - Choanocytes 4 - Cnidocytes 5 - P...
Q: Study the following scenario. Plot the 5-day menstrual dates in the calendar provided in the activit...
A: Menstruation is a 3-5-day period in which a bloody fluid containing endometrial cells, glandular sec...
Q: Adequately describe how the collection and analysis of evidence in this cases helped the police in a...
A: DNA fingerprinting for forensic evidence, plays a important role in identifying the assailant (perso...
Q: A. Observation of growth characteristics on selective and differential media Mannitol salt Agar Bact...
A: S.aureus stands for staphylococcus aureus. If we are to grow this bacteria in Mannitol salt agar med...
Q: What are some research-able questions about the Corona Virus?
A: Some research able questions about corona virus are listed below
Q: What is the Malthusian Theory? Is the Malthusian Theory applicable today or not at all? Please expla...
A: Introduction A population is a group of individuals of the same species who live in the same region ...
Q: Draw the bond-line structure of the given peptides. 1. Ser-Asp 2. Glu-Gln 3. Arg-His
A: Bond line structure of the amino acids reveals the covalent bonding, hydrogen bonding and peptide li...
Q: It all about flowering plants-use for asexual and sexual reproduction example Please help it is due ...
A: Sexual maturity is the age in which the reproductive organs mature and mating occurs. In context of ...
Q: In rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears....
A: Introduction The relationship between two gene variants is referred to as dominant. Each parent give...
Q: Explain in detail difference between homothalism and heterothalism
A: Aspergillus species are homothallic fungi, while Saccharomyces cerevisiae, Aspergillus fumigatus, As...
Q: Fill in the blank with the most appropriate term that is described by the following statement: Can s...
A: DNA polymerase completes the most common way of duplicating parental DNA to form daughter DNA partic...
Q: Expansins are activated by acidic conditions that modify the A. Hydrogen bonds between lignin and ce...
A: Cell wall surrounds the cell membrane (also known as plasma membrane) and provides rigidity to the c...
Q: Use the Punnett square below to answer the questions that follow. mH mh MH MMHH MmHh Mh MmHh Mmhh
A: 1. The punnett shows 2 alleles for 2 genes each hence first statement is True. 2. There are four dif...
Q: Explain the "antigen recognition by cells of adaptive immunity" in a simple way
A: Introduction The adaptive immune system, also known as the acquired immune system, is a subsystem of...
Q: Explain characteristics of peranosporales ,agaricales, polyporales and ustilaginales in detail.
A: Answer
Q: In horses, the coat color black is dominant (B) over chestnut (b). The trotting gait is dominant (T)...
A: A dihybrid cross is a cross in which two traits are involved. As per the question , two traits are ...
Q: What is the weight of a 100 kg individual?
A: Given , Mass of an individual as 100kg Mass is a scalar quantity and it doesn't change whe...
Q: Base on your own opinion, what does genetics mean? What is its relationship to all living things? ...
A: Term genetics was given by William Bateson. Gregor Mendel is known as father of genetics. *Only fi...
Q: can you please explain to me how twin studies can reveal whether or not the appearance of a trait is...
A: Identical twins share the same Genetic pattern whereas non identical twins doesn't have the same Gen...
Q: Why is it an advantage for eukaryotic cells to have different compartments (aka organelles) in the c...
A: Introduction Organelles are small structures that work together in the cytoplasm to carry out life f...
Q: e blank with the correct dilution for each tube in the series. tou 50 µl of patient serum 100 µl of ...
A: Dilution is the technique of lowering the concentration of a solute in a solution by merely adding m...
Q: Part A) How does the molecular mechanism of elongation arrest by SRP differ between Bacillus and Mam...
A: Introduction: The SRP targeting mechanism's co-translational nature is most likely to blame for its...
Q: Which type of virus must contain an RNA replicase packaged in the viral particle in order to carry o...
A: A virus is a small collection of genetic code, it can be DNA or RNA, surrounded by a protein coat ,...
Q: List down at least 5 sex-linked traits/disorders located in the p arm and in the q arm. p arm q arm
A: Sex-related disorders are inherited via one of the sex chromosomes, the X or Y. Dominant inheritance...
Q: umetes could be produced from the following diploid genotype? AaBb answer and submit. For keyboard n...
A: Gametes are formed during meiosis and they are separated or segregated during this time. Gamete of d...
Q: ee modes of dosage compensation exist in nature. riefly, describe the three different strategies. /h...
A: Males and females of several species have different sex chromosomes and in order to equalise their ...
Q: List atleast 50 laboratory equipments or tools. Just list, no need to give the uses
A: ANSWER;- 50 laboratory is;-
Q: For goldfish, solid orange coloring is dominant while orange with black spots is recessive. A total...
A: Recessive genotype frequency = q2 = 225/2500=0 .09 Recessive allele frequency=q= Sqrt of q2 =0.3 ...
Q: Explain characteristics of oomycota? Explain characteristics of mucarales ?
A: Unlike to fund the members of the Phylum oomycota lack chitin in their cell walls and have a life cy...
Q: 4. Compare and contrast compact and spongy bone. 国 compact spongy Density of minerals? Strength? Red...
A: Introduction Bones are made up of a framework of collagen, a protein, and calcium phosphate, a miner...
Q: Explain about the mechanism of genotoxic agent in validating the regulator and pathway from article ...
A: Candida glabrata, a nosocomial fungal bloodstream pathogen, causes significant morbidity and mortali...
Q: Differentiate between: a. Biotic and abiotic component
A: An ecosystem is shaped by its biotic component. These are communities of organisms made up of variou...
Q: What's the difference between natural and artificial flavors?
A: Introduction A food flavoring or flavoring, often known as flavoring or flavouring, or fragrance, i...
Q: ou have a farm with calves having issues with scours at 7-10 days of age. You want to esign a vaccin...
A: A.. An intestinal scour vaccine and injectable scour vaccine. B.. Calves are most at risk of calf sc...
Q: Where on a membrane would you find peripheral proteins? List at least 3 of the functions of peripher...
A: Introduction The cell membrane is a biological membrane that protects and isolates the interior of a...
Q: A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following sequ...
A: Transcription is a process of copying a piece of DNA into RNA.
match the listed events to note if they would, or would not, occur in a neuron under the effects of tetrodotoxin. the cell has a resting membrane potential of -65mV. You should match these events at the initial segment of a bipolar neuron,
**Answer choice for all ( would occur, would not occur)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Conformational changes in channel proteins brought about by voltage changes are responsible for opening and closing Na+ and K+ gates during the generation of an action potential. (True or false?)Describe the action potential in terms of the different functional states of the voltage- gated Na+ membrane channels (Note: there are three states)excitatory and 15 inhibitory postsynaptic potentials appear simultaneously on the plasmatic membrane of motoneuron. Answer the question A and fulfill the task B:A) Will this neuron generate the efferent nervous impulses if the amplitude of single EPSP and IPSP appeared on the axonal hillock`s membrane equals 1 mV? Why?B) Name the state of this neuron and name the type of summation
- Draw a typical action potential (correctly label axis) and explain in words the roles of ion channels in generating the different phases of the action potential. (Extra credit: How would opening voltage gated calcium channels upon depolarization affect the shape of the action potential if they have a relatively slow inactivation rate?)At the peak of the action potential, Vm is approximately -65 mV. Assuming normal intracellular and extracellular K+ concentrations (refer to the table), (1) calculate the driving force (in mV) that acts on K+ ions and (2) use the information obtained in part 1 to determine the direction in which K+ ions will flow (i.e., into the cell or out of cell)Action potentials are “all or none.” Discuss this statement with reference to specific types of channels (60%). Explain what determines the frequency of action potentials (40%).
- A loss-of-function mutation in the ion channel responsible for thegeneration of end-plate potentials results in a diminished permeabilityof the ion channel. 1) How would you experimentally test the effect of the mutation on thefunctional properties of the cell (synapse)? You should discuss the typesof postsynaptic responses and physiological parameters you couldmeasure.What is the expected resting membrane potential (in mV) of a neuron that is typical in all ways except for possessing an intracellular potassium concentration of 94 mM and double the normal resting permeability to sodium?Is the resting membrane potential the bases of conduction in nerves and muscle fibers and the presecutors of contraction in muscles?
- Compare the resting membrane potential of a neuron with the potassium and sodium equilibrium potentials. Explain how this comparison relates to the relative permeabilities of the resting plasma membrane to these two ions.In the figure to the left, name the 4 phases of the action potential (Note: you have to write in where phase 4 occurs). Describe what happens in each phase with a focus on Na+ and K+ flow through channels and the membrane potential. Discuss the importance of threshold. How does this relate to the concept of APs being all or none?[Na*] [K*] This diagram is a drawing of normal conditions that occur in a neuron's axon (not all details are included). This stage that a living neuron would be in, would show that O no positive ions are inside the cell current is traveling down the axon O the cell will be at rest once the Na ions enter the cell O the cell is at rest O Na ions are predominantly outside the cell