Cross a heterozygous pea plant with a homozygous recessive pea plant. Draw a Punnett square to show the possible offspring of the cross.

Q: What are the conditions that might cause a cell to halt the cell cycle

A: Introduction: A cell cycle is a set of events that occur in a cell as it divides and grows. A cell s...

Q: A trihybrid individual with the genotype QqRrTt is testcrossed with a qqrrtt individual. The resulti...

A: A trihybrid cross is a cross between two individuals of the same species for the purpose of studying...

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of  DNA is unique to all individuals. ...

Q: Enumerate 5 important features of the DNA. Choose ONE from your list and elaborate on how this feat...

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...

Q: An abundance of misfolded proteins in the ER can result in the activation of the unfolded-protein re...

A: Endoplasmic Reticulum can be referred to as one of the organelles of cell that can be observed in th...

Q: Figure It Out #5...Name that Complex Carb Fiber Sucrose Starch and Fiber Human Brain Human Liver Coo...

A: Galactose: Human Brain Fiber and Starch: Whole wheat bread Fiber and Sucrose: Starburst, Strawberry ...

Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short leng...

A: The transcription is the process by which RNA is produced from the DNA template and the translation ...

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand. —ссс...

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is transl...

Q: 1. Reports about a man who successfully undergone xenotransplantation of a pig heart in replacement ...

A: Introduction :- Transplantation is method or process by which the cells , tissues , organs are trans...

Q: How can people effectively manage stress when diagnosed with cardiovascular conditions?

A: When people diagnosed cardiovascular conditions than how can manage stress

Q: Describe crossing over and how it introduces variation in traitsamong the offspring of sexual reprod...

A: The offspring of sexual reproduction inherit genes from both parents. Furthermore, the offspring pro...

Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а....

A: Transcription is the initial stage in gene expression, when genetic information is utilised to build...

Q: Match each term with the best description. ___ DNA replication                a. basis of variation ...

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA (deoxyri...

Q: Mitochondrial oxidation of fatty acids is a major source of ATP, yet fatty acids can be oxidized els...

A: Introduction  All cells require energy to survive and energy comes from respiration or metabolism. T...

Q: What are the main elements of the lac operon and their functions?

A: Operon is the the prokaryotic gene regulatory system in which the expression of polycistronic mRNA i...

Q: (a) Gryllus pennsylvanicus prefers sandy soil. (b) Gryllus firmus prefers loamy soil. Based on the i...

A: Geographic, behavioural, physiologic, or genomic obstacles or differences that prevent a species fro...

Q: What property of the various cytochromes ensures unidirectional electron flow along the electron-tra...

A: Cytochromes, a family of metalloproteins which performs one-electron transfer reactions, in biologic...

Q: Define the following terms: Bactericidal Bacteriostatic Antisepsis

A: Microorganisms are microscopic and most of them causes harmful effects in human body, but some of th...

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are con...

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and beco...

Q: similarities and differences between malaria and covid 19

A: An infection is the invasion of an organism's body tissues by disease-causing agents, their multipli...

Q: You are part of the radiology team at an ER.  A 6 year old child comes in, who may have a broken bon...

A: Interpretation of the broken bone X-ray 

Q: Frog Human Dog -Lizard Duck Whale Duck and whale are close relatives. Frog is equally related to bot...

A: Phylogenic tree is a diagrammatic representation showing evolutionary relationships between organism...

Q: Identify

A: The organism which causes the above shown infection is Candida albicans.  

Q: One of the autosomal loci controlling eye color in fruit flies has two alleles: one for brown eyes a...

A: The fruit fly's color of the eye is further controlled by the autosomal locus. The given fly compris...

Q: The cell pictured to the right is in whichstage of nuclear division?a. metaphase II c. anaphase IIb....

A: Mitosis is the phase of the cell cycle where the nucleus of a cell is divided into two nuclei with a...

Q: what is sumoylation and how does it affects newly synthesized proteins?

A: SUMO proteins (Small Ubiquitin-like Modifiers) are a family of small proteins that are covalently at...

Q: How many N-terminus are there in this cartoon?

A: *There are four types of protein structure are present. primary structure secondary structure terti...

Q: Illustrate a hypothetical food web of the seagrass ecosystem services by using words and arrows

A: * food web is interconnection of food chains and a graphical representation of eating behaviour  in ...

Q: What electron-transport components participate in the Q cycle in mitochondria, in purple bacteria, a...

A: The electron transport chain is also called the Cytochrome oxidase system or as the Respiratory chai...

Q: 3. Explain the movement of indirect protein transport; where are the proteins made, WHere Jie they g...

A: Mechanical protein digestion begins in the mouth and progresses to the stomach and small intestine. ...

Q: Disorder of Sex Determination Now that you have reviewed typical sexual determination in humans, it ...

A: Swyer syndrome  It is an uncommon disorder that causes the sex glands (testicles or ovaries) to fai...

Q: In mice, agouti fur color is dominant overr albino fur. Complete a Punnett square that crosses a het...

A: Given, agouti color fur in mice is dominant over albino fur. It is also given to cross a heterozygou...

Q: petty larceny, killing animals, and was a bully. Sonny likely has personality disorder.

A: Answer is Option C AntiSocial. If a person having this Antisocial personality disorder he will be ve...

Q: Briefly answer the question below: What is the disadvantage of having a really thick smear when stai...

A: Smear:- It is used to fix the bacteria onto the slide and to prevent the sample from being lost duri...

Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...

A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...

Q: Question 25 Which of the following statements is NOT true? O 45% of the incoming shortwave radiation...

A: The incoming solar radiation that hits the boundary between the Earth's atmosphere and outer space, ...

Q: Dr. Robinson loves to cross-country skit After a 2 hour ski, there is an increase in epinephrine lev...

A: As per our company guideline we are supposed to answer only first question or first 3 sub parts of t...

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: List the sequences of RNA that would be transcribed from the following DNA template sequences. TTAC...

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that ...

Q: Maximal production of ATP from glucose involves the reactions of glycolysis, the citric acid cycle, ...

A: Cellular respiration is the process by which organisms utilize oxygen to break down complex food mol...

Q: Mitosis and cytoplasmic division function in .a. asexual reproduction of single-celled prokaryotesb....

A: Mitosis and cytoplasmic division are described as a process where the cell of an organism is divided...

Q: The world has been greatly affected by the pandemic caused by COVID-19. Countries all over the world...

A: The pandemic caused by the novel Corona virus has devastatingly affected the countries around the wo...

Q: There are two broad classes of transposons. Each class is characterized by its method of "jumping" (...

A:    

Q: Create a flow chart on how to prepare a nutrient agar

A:                                                                      Nutrient Agar            ...

Q: List and explain at least 3 Bacterial infections of the skin

A: EXPLANATIONBacterial skin infection: Bacterial skin infections form when bacteria enter through hair...

Q: the

A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic acid...

Q: 3. Describe the effect of malaria on the frequency of the Hbs allele in areas where is common in are...

A: Sickle cell anaemia results in the single amino acid change in the beta chain of globin protein that...

Q: How does the translated mRNA convert into a functional protein?

A: Translation is a process in which cells make the proteins. 

Q: Identify the type of flagella from the picture

A: Introduction :- Flagella are the locomotory structures which are present of the cell surface and all...

Q: Offer evidence in support of the hypothesis that meiosis evolvedfrom mutations in the process of mit...

A: The process that helps in the development of daughter cell from parent cell can be termed as cell di...

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.