Consider a cell in which nondisjunction occurs for all chromosomes during meiosis I. What would be the result of this event? Multiple Choice two diploid gametes two haploid gametes and one aneuploid gamete with an extra set of chromosomes four aneuploid gametes four haploid gametes

Consider a cell in which nondisjunction occurs for all chromosomes during meiosis I. What would be the result of this event? Multiple Choice two diploid gametes two haploid gametes and one aneuploid gamete with an extra set of chromosomes four aneuploid gametes four haploid gametes

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter13: Modern Understandings Of Inheritance

Section: Chapter Questions

Problem 3VCQ: Figure 13.6 Which of the following statements about nondisjunction is true? Nondisjunction only...

See similar textbooks

Related questions

Q: What is the advantage of using Molecular data compared to plated/tube culture or…

A: For the study of various diseases caused by microbes, it is very important that the correct…

Q: (Part B) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would…

A: Coenzymes are the cofactors or the organic molecule which helps the enzymes in catalyzing various…

Q: Recent studies have found instances of transgenerational inheritance of epigenetic traits in humans…

A: Researchers have examined how parents' activities influence their children, indeed if those…

Q: Diabetes insipidus:* a. Hypernatremia due to decreased water intake b. Hypernatremia due to excess…

A: Diabetes insipidus is a disorder that occurs when there are low levels of ADH (Antidiuretic hormone)…

Q: Describe your results in the following data chart as directed in the instructions for the laboratory…

A: TreatmentGrowthControl+++0.01% bleach-0.1% bleach-1.0% bleach-2.5% Lysol-5% Lysol-10% Lysol-0.03%…

Q: 3 Survey different smokers and find out how many cigarettes they smoke in one day. Most cigarettes…

A: Lung cancer is a type of cancer that begins in the lungs and spreads to other parts of the body.…

Q: The figure below represents the size of various SSRS that are used for forensic analysis. The bars…

A: Microsatellites, commonly referred to as Simple Sequence Repeats (SSRs), are brief repeated DNA…

Q: Give only typing answer with explanation and conclusion Semi-discontinuous DNA replication, in the…

A: The procedure of copying a DNA molecule to create duplicate identical daughter strands is known as…

Q: Using the following diagram, a. name all the steps in citric acid cycle. (What are the…

A: The steps in the citric acid cycle, also known as the Krebs cycle or tricarboxylic acid (TCA)…

Q: Ultimately, as a tactical athlete, the goal is to maximize the strength to bodyweight ratio, and…

A: There are diverse ways to reach the correct mix of strength, speed, perseverance, and body weight…

Q: Which of the following RNA molecules is to the sequence: 5' AGGCTCAAGCGT - 3'? complementary O a.…

A: RNA is a single stranded nucleic acid which plays a key role in gene expression and protein…

Q: Explain the process of what electrophysiology is, include some disscussion about things that…

A: Electrophysiology is a branch of biology and medicine that investigates the electrical activity of…

Q: What is a microbiome? What is the human microbiome and how is it important to human health? What do…

A: The microbiome refers to the community of microorganisms that live on and inside the human body,…

Q: If a cell has a diploid number of 12 chromosomes before meiosis I and meiosis II, how many…

A: The process by which two sets of chromosomes migrate in the same pole during segregation (gamete…

Q: identify a disease that can be caused by a K+ or Na+ transport channel malfunctioning. What are the…

A: Transport channels for ions are large protein spanning the membrane to allow selective transport of…

Q: If two individuals are crossed (RrYy x RrYy), what percentage of their offspring will display the…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Explain Emulsions. What variations are there? Give an illustration of each category. Create two…

A: Emulsion is the dispersion of two liquids that are unblendable. The liquids do not mix each other.…

Q: discuss the camp test and beta hemolysis in L. monocytogenes. Give the principles, procedures,…

A: Listeria monocytogenes is a gram positive, motile and rod shaped bacteria. They are facultative…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: What proteins are crucial for creating and maintaining DNA replication forks? Choose the best…

A: Replication in the process in which double stranded-DNA is duplicated or copied to produce two…

Q: Considering the symptoms and current explanations for why someone might develop a Mental/Behavioral…

A: Schizophrenia is a serious mental health disorder that affects how a person thinks, feels, and…

Q: Describe, with examples the role of the cell membrane and cytoskeleton in mitosis.

A: During the process of mitosis, the cell membrane and cytoskeleton play vital roles in facilitating…

Q: Parts A-C in the table show the genotypes for two partial diploid strains of the lac operon. Gene…

A: A group of genes called the lac operon are involved in the bacterial metabolism of lactose. *Three…

Q: Why are biologic systems such as red blood cells and guppies susceptible to osmotic injury? They are…

A: Osmotic injury is the osmotic shock or osmotic stress. This is special type of physiological…

Q: describe the yeast specimens grown on PDA using Dalmau Plate Method incubated at 35°C for 48 hours…

A: Fungi belong to the kingdom Fungi. They are eukaryotic and multicellular organisms. But yeast is a…

Q: For what purpose is mitochondrial genomics used? Question 20 options: Forensic analysis…

A: Mitochondria - Mitochondria are organelles found in the cells of most eukaryotic organisms,…

Q: 11. Why does Vincent tell Irene. "You are the authority of what is not possible"? How does Vincent…

A: The concept of Gattaca is simple and brilliant: in the near future, genetic engineering enables…

Q: Which aqueous solution should have the most different freezing point from pure water (neglecting ion…

A: If ion pair formation is disregarded, the concentration of particles of solute can be used to choose…

Q: Complete the following by giving one ORIGINAL example (one of your own) in 2-3 complete sentences…

A: Tardive Dyskinesia is a neurological condition characterized by involuntary, repetitive movements…

Q: . 31 = Acid and Gas Production from Sugar Fermentation (p. 269) What is fermentation? How can we…

A: Sugar Fermentation test is otherwise known as carbohydrate fermentation test. Microorganisms…

Q: A diploid trihybrid plant was testcrossed. Each of the three genes determines a single Mendelian…

A: Let's represent the three genes as A, B and C.The two parents that were crossed to form the diploid…

Q: The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The…

A: Transcription - Transcription refers to the process by which genetic information encoded in DNA is…

Q: Which of the following statements about Bacillus thuringiensis (Bt) corn are correct? Select all…

A: Genetically Modified Organism is referred to as GMO. Any living thing whose genetic makeup has been…

Q: Figure 8.2: Male vs Female fruit flies The flies in the image below are your ACTUAL data for the…

A: The sex of the drosophila can be determined by their size, because, female drosophila are larger in…

Q: For the guy micro biome Find a recent (2015 or newer) primary research article that investigates…

A: Gut microbiome are the collection of all microbes, they are like bacteria, virus and also their…

Q: 2. Many health issues have been discussed throughout the semester. Identify a lifestyle choice that…

A: Life style change means modifying things we each have control over like changes in diet on daily…

Q: In a clinical context, doctors are evaluating a therapy for a new patient (say patient B) that they…

A: In the setting of assessing treatment for a modern patient (patient B) who may develop comparable…

Q: If the liver can produce 5 mg of albumen per day, what is its contribution to the concentration in…

A: The body's circulatory system, or blood, is a critical fluid connective tissue that carries vital…

Q: 5. Anabolic steroid use can provide athletes with benefits during training and performance. Provide…

A: Anabolic steroids are also called anabolic-androgenic steroids. these category of drugs derivatives…

Q: tell whether the curves for the different cohorts are different from one another. If so, what might…

A: We are given the curves for the different cohorts, and we must examine them to see whether there's…

Q: What are some the products of the third stage of metabolism? 1. AcCoA, NH3 and O2 2. TCA…

A: Cellular respiration is a series of metabolic processes that take place inside cells to transform…

Q: Give typing answer with explanation and conclusion to all parts Which of the following factors…

A: The ability of bacteria or other microorganisms to withstand the effects of antibiotics that were…

Q: The increase in fast food establishments on Kirkwood Avenue is taking a deadly toll on the squirrels…

A: Familial hypercholesterolemia (FH), an autosomal dominant genetic condition produced by mutations in…

Q: What is the H1N1 virus? What happens when someone has contracted the virus? Describe normal…

A: The term "virus" refers to a microscopic pathogen that can only multiply within cells of living…

Q: You are a physician working in a hospital. Your patient is a 65-year-old individual who has been…

A: A group of bacteria called Mycobacterium has a number of species, some of which are known to be…

Q: The image below shows a sarcomere. Which region of sarcomere does each letter represent?

A: The contractile unit of skeleton muscle is known as sarcomere. The actin and myosin filaments are…

Q: What is Schistosomiasis? write a short paragraph about Schistosomiasis

A: A plant or animal that lives on, alongside, or inside a larger species and extracts nutrients is…

Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…

A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…

Q: 5. Read the article on the following pages and answer the questions below. Be sure to review the…

A: Vaccination plays a crucial role in preventing the spread of infectious diseases and protecting…

Q: Which of the following scenarios would lead to severe hypoglycemia? Choice 1 of 6: A non-diabetic…

A: Hypoglycemia refers to a condition characterized by low blood glucose levels, commonly known as low…

Concept explainers

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase.

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons:

Question

Consider a cell in which nondisjunction occurs for all chromosomes during meiosis I. What would be the result of this event?
Multiple Choice
two diploid gametes
two haploid gametes and one aneuploid gamete with an extra set of chromosomes
four aneuploid gametes
four haploid gametes

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: definition of disjunction of chromosome

VIEW

Step 2: Explanation of the chromosomal nondisjunction result in meiosis l stage

VIEW

Step 3: Explanation of incorrect options

VIEW

Step 4: Conclusion

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Figure 13.6 Which of the following statements about nondisjunction is true? Nondisjunction only results in gametes with n+1 or n-1 chromosomes. Nondisjunction occurring during meiosis II results in 50 percent normal gametes. Nondisjunction during meiosis I results in 50 percent normal gametes. Nondisjunction always results in four different kinds of gametes.
The chromosome constitution number of this individual is 2=6. This drawing represents: a. mitotic metaphase. b. meiotic metaphase I. c. meiotic metaphase II. d. a gamete. e. sixnonhomologous chromosomes.
Match the phase of cell division with the following diagrams. In these cells, 2n = 4. a. anaphase of meiosis I b. interphase of mitosis c. metaphase of mitosis d. metaphase of meiosis I e. metaphase of meiosis II
Compare meiotic anaphase I with meiotic anaphase II. Which meiotic anaphase is most similar to the mitotic anaphase?
A cell has a diploid number of 6 (2n = 6). a. Draw the cell in metaphase of meiosis I. b. Draw the cell in metaphase of mitosis. c. How many chromosomes are present in a daughter cell after meiosis I? d. How many chromatids are present in a daughter cell after meiosis II? e. How many chromosomes are present in a daughter cell after mitosis? f. How many pairs of homologous chromosomes are visible in the cell in metaphase of meiosis I?
A cell (2n = 4) has undergone cell division. Daughter cells have the following chromosome content. Has this cell undergone mitosis, meiosis I, or meiosis II?
Tetraploidy may result from: a. lack of cytokinesis in meiosis II b. nondisjunction in meiosis I c. lack of cytokinesis in mitosis d. nondisjunction in mitosis in the early embryo e. none of these
After telophase Il of meiosis, the chromosomal makeup of each daughter cell is: Practia diploid, and the chromosomes are each composed of a single chromatid. O diploid, and the chromosomes are each composed of two chromatids. O haploid, and the chromosomes are each composed of a single chromatid. O haploid, and the chromosomes are each composed of two chromatids.
in the experiment of following chromosomal dna mvement througgh meiosis, why. do you use non-sister chromatids to demobstrate crossing over? what combinatiobns of alleles could result from a crossover between BD and bd chromosomes? Identify two ways that meiosis contributes to genetic recombination. Why is it necessary to reduce the number of chromosomes in gametes, but not in other cell?
eiosis mod e correct order. 4 Compare the models of the two processes. List all of the differences you can see between meiosis and mitosis below. Northern Virginia Community Collego 188 I BIO 142 Human Anatomy and Physiology II
In meiosis, fully formed spindle fiber can be found in - O only Metaphase I in plant cells Metaphase I and Anaphase I in plant cells O Metaphase I and Metaphase II in only animal cells O Metaphase I and Metaphase II in only plant cells O only Metaphase I in animal cells O Metaphase I and Metaphase II in both plant and animal cells
In the moss Polytrichum commune, the haploidchromosome number is 7. A haploid male gametefuses with a haploid female gamete to form a diploid cell that divides and develops into the multicellular sporophyte. Cells of the sporophyte thenundergo meiosis to produce haploid cells calledspores. What is the probability that an individualspore will contain a set of chromosomes all ofwhich came from the male gamete?