Choanoflagellates Porife ponges Plants Fungi Choanoflagellates Animals Amoebozoa Acoelomorpha Rotifera (rotifers) Animalia Bilateria Protostoma Lophotrochozoa (snails, clams Segmentation Acoelom Pseudocoelom Pseudocoelom Ecdysozoa (round spodo (insects, spiders, Segmen tation Protostome development Growth by molting Deuterostome development Coelom Triploblasty (origin of mesoderm) Bilateral symmetry and cephalization Radial symmetry Diploblasty (ectoderm and endoderm) Epithelial tissue Multicellularity Sponges show radial symmetry. Which organisms demonstrate a homoplasy with sponges? Annelids Echinodermata Chordata Mollusca * Radial symmetry (in adults Deuterostoma Chordata (vertebrates ascidians) Segmen tation

Q: 9. For each of the following experimental goals, is PCR or gene cloning preferable and why? a.…

A: Approach to solving the question: a thorough way of answering. I hope this helps! Detailed…

Q: 4. Which is an important tip to follow when toileting a person with Alzheimer’s disease?…

A: A. Providing Easy-to-Remove Clothing (Best Choice):• Dignity and Independence: People with…

Q: The English physiologist William Harvey made all of the following circulatory discoveries except:…

A: Harvey demonstrated that blood flow through the veins is unidirectional, with valves to prevent…

Q: 7. Suppose you used Hippo and Wts constructs to test their relationships with Y. You found that the…

A: Rationale for the Correct Answer:Wts reverses the Y mutant phenotype: This indicates that Wts can…

Q: According to chemist John Dalton, if one mole of oxygen is combined with two moles of hydrogen to…

A: The atomic mass of an element is the weighted average mass of the atoms in a naturally occurring…

Q: Given the sequence of the DNA template as GTCATG, what would be the sequence of the mRNA? a. CAGTAC…

A: Here are some of the points to consider the mRNA from DNA; 1. RNA Nucleotides: RNA differs from DNA…

Q: Genetics Question 5

A: The objective of the question is to identify an alternative method for gene therapy for muscular…

Q: According to Robert Boyle, the first president of the Royal Society of London, if 2 cubic meters of…

A: Boyle's Law, named after physicist Robert Boyle, states that the pressure and volume of a gas have…

Q: The rate of plant growth on an island near Isle Royale is such that the carrying capacity of moose…

A: 1. Initial conditions: Initially, there are 450 moose on the island, and the environment is stable…

Q: How to solve the genotype, allele, and phenotype frequency.

A: The first step is to compute the allele frequencies:  Allele frequencies are numerical…

Q: British colonists of North America brought beer yeasts with them when they settled in North America…

A: The two most likely explanations are: E. The differences are due to random differences in the small…

Q: Charles Darwin’s claim, that the species level of classification is just as arbitrary as that of any…

A: In biology, a species is the basic unit of classification. It is defined as the largest group of…

Q: 6. What is the key to ADL success? Negative body language Doing the task for the person…

A: Preparation:Preparation is undoubtedly the cornerstone of success in activities of daily living…

Q: Do you think the current conversation about abortion makes good arguments? If so, what is…

A: I hope these suggestions and recommendations help you with your assigned tasks.  Have a great day…

Q: once proteins are formed in the cell how does the protein get there

A: The question is asking about the process by which proteins, once synthesized in a cell, reach their…

Q: What is CRISPR? Give two applications for this technology.

A: CRISPR, which stands for Clustered Regularly Interspaced Short Palindromic Repeats, is a family of…

Q: The Swedish botanist Carolus Linnaeus was the first taxonomist to argue that, contrary to Aristotle:…

A: Carolus Linnaeus, a Swedish botanist, is known as the father of modern taxonomy. He developed a…

Q: Anne had the smallpox virus. She is unlikely to get sick if she is infected with the smallpox virus…

A: The question is asking whether Anne, who has previously been infected with the smallpox virus and…

Q: (Q003) What is the minimum number of individuals (MNI) represented? a) 1 B)4 C)2 This anthro please…

A: Approach to solving the question: Detailed explanation:(Q003) Minimum Number of Individuals (MNI)…

Q: I need help indicating occurrences of homoplasy  in the data matrix

A: To analyze occurrences of homoplasy in your data matrix, you need to first structure and interpret…

Q: solve this with step by step calcuations please

A: 1. **Amount of DNA in the 1-kb band:**  We want to ensure that we have enough DNA in the 1-kb band…

Q: Which of the following ideas proposed by Charles Darwin suggested a possible way for non-living…

A: The question is asking us to identify which of the listed concepts, associated with Charles Darwin,…

Q: 10. Why should employers be especially careful about harassment when sponsoring social events such…

A: Employers should be especially careful about harassment when sponsoring social events such as…

Q: Genetics Question 10

A: We are using PCR (Polymerase Chain Reaction) and Gel Electrophoresis to analyze two specific genes…

Q: Charles Darwin’s claim, that the species level of classification is just as arbitrary as that of any…

A: The question is asking us to identify which of the given scenarios does not support Charles Darwin's…

Q: A ALEKS - Julianna Graham-L x + New Chrome available…

A: Background on Semi-conservative ReplicationSince DNA replication is semi-conservative, one strand…

Q: Is caviar a fish? Where does it come from?

A: Links for…

Q: Cell division cycle (cdc) mutations identify genes, the normal products of which are..…

A: Gene Function: CDC mutations pinpoint genes that are vital for regulating the cell division cycle.…

Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…

A: Jean-Baptiste Lamarck was a French biologist who proposed one of the earliest theories of evolution.…

Q: I need help with this question please

A: a. Community 1 and 2 have the same species richness or total number of different species which is…

Q: STRs normally consist of repeating sequences of:   Question 46 options:   13-17 bases.…

A: Short Tandem Repeats (STRs) are a type of molecular marker used in genetics. They are short…

Q: Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of…

A: Reaction A: Protein X only. No DNA probe or antibody present. This is inferred because there is no…

Q: Which of the following examples suggested to Charles Darwin that hybridization between different…

A: The example that most suggests hybridization between different species offered no benefit to the…

Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…

A: The objective of the question is to understand the pathophysiology of an Upper Respiratory Tract…

Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…

A: The objective of the question is to understand the evidence presented by Georges Cuvier that…

Q: i need help woth this question

A: Step 1:The increase in pressure with depth in the ocean is given by the hydrostatic pressure…

Q: Which of these student models shows the evolutionary relationship between chimps and humans? Humans…

A: Answer:   Explanation:Fossil records and genetic evidence show that humans and chimpanzees shared a…

Q: The phylogentic tree below depicts the evolutionary relationships of the following species A through…

A: Evolutionary time is not important in determining the relationship between the species in a…

Q: A specific pattern of activation is observed in the right hemisphere piriform cortex in response to…

A: To determine which statement must be true based on the specific pattern of activation observed in…

Q: How do these molecule function: Nucleic Acid, DNA,Messenger RNA (mRNA), Transfer RNA (tRNA),…

A: The question is asking about the functions of various biological molecules, specifically nucleic…

Q: Based on the sequence data in the figure above, would you consider the patient to be not affected,…

A: Based on the information provided in the figure above, it can be concluded that the patient is…

Q: Which of the following is considered best practice when designing protected areas? Which of…

A: It is best that the protected area is round in shape.Incorrect: While round shapes can simplify…

Q: 2. Below is an example of an image of genomic DNA extracted from whole blood analysed by agarose gel…

A: Answer well explained above.

Q: Pick all that are true   Microbial evolution is responsible for: The eukaryotic cell…

A: Microbial evolution is responsible for: The eukaryotic cell The statement is TRUE. Microbial…

Q: 1. Which of these statements about workplace bullying is correct? The term is another way of…

A: The problem of bullying in the workplace is widespread and has the potential to have negative…

Q: This is from the Wilson et al. article.

A: Primer PC3mod (PURPLE)Recognition sequence: 5' TGCCAGCGAGTCAAGTCGGGAACTCT 3'Direction of…

Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…

A: The objective of this question is to create a pathophysiology flow chart for an Upper Respiratory…

Q: +…

A: To determine the base sequences for a silent mutation and a non-silent (or missense) mutation in the…

Q: According to Stephen Hales, if systolic blood pressure and diastolic blood pressure in the brachial…

A: Let's break down the calculation step by step.Pulse pressure (PP) is a measure of the force that the…

Q: What evidence did Georges Cuvier present that contradicted one of Jean-Baptiste Lamarck’s ideas? he…

A: Jean-Baptiste Lamarck was a French biologist who proposed one of the earliest theories of evolution.…