Q: Suppose you were told that mining deep-oceanmineral resources would mean severely degradingocean…
A: Mining refers to process of extracting minerals by digging sea,land etc. Land resources are…
Q: Identify the missing components and write their names against the numbers 1-7 given below:
A: Introduction The Wnt pathway is a signal transduction pathway that is known for the regulation of…
Q: ACTIVITY :- Prepare a flow chart on type of Microorganisms and draw suitable labelled diagram and…
A: Introduction Microorganisms are small organisms that are not seen by the naked eyes. They are…
Q: For the following problem: Identify the gametes for each parent, build a Punnett Square of the…
A: Brown fur (B) is dominated over the gray fur (b). Cross occurs between the homozygous dominant mouse…
Q: On a recent episode of CSI, multiple people came forward claiming to be parents of a crime victim.…
A: Concept used: Blood grouping Definitions required: The blood group of an offspring is generally…
Q: background infomation about E.coli and molecular process that takes place
A: Microbiology: The study of tiny creatures' biology includes viruses, bacteria, algae, fungus, slime…
Q: Summary 1. Explain the results of alcoholic fermentation for Tubes A, B, and C. Tube A Tube B Tube…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Assuming the technology and expertise is ready and available, which specific human/animal/world…
A: Introduction Unlike eukaryotic cells in plants and animals, prokaryotic cells such as bacteria…
Q: Name the respiratory centre found in Pons that is responsible for increasing the breathing rate.
A: Respiratory centre usually present in brain stem especially in the medulla oblongata as well as in…
Q: Proposal 2. In physical science courses: Earthquakes are caused by deities angered by the actions of…
A: Intelligent design (ID), which its proponents promote as "an evidence-based scientific explanation…
Q: Determine what kind of evidence would support the hypothesis that birds evolved from dinosaurs.
A: Introduction In biology, the gradual and slow change in characteristics both genotypically and…
Q: Cindy and Larry have 2 children. One child has type O blood and the other child has type AB blood.…
A: (According to bartleby guidelines, only the first three have been answered. Kindly post the…
Q: If the following cross occurred AAbb x aaBB, what is the probability of getting an offspring that is…
A: Introduction Alleles are the hereditary units on the chromosomes that control specific traits or…
Q: Internal tooth resorption is the loss of dentin and other tooth tissues from the inside, often…
A: Introduction: Internal root resorption (IRR) is a pathologic condition characterized by dentine…
Q: How do the number of fatalities related to heat waves compare to the number of deaths caused by…
A: A heatwave is a period of extreme heat accompanied by high humidity, especially in countries with a…
Q: hy is the Baermann-Moraes method suitable for a suspect strongyloidiasis? Why is it considered a…
A: Strongyloidiasis is a disease caused the nematode Strongyloides stercoralis. It is believed to…
Q: Explain the following areas about (X-ray machines) 1. What are the ingredients the device? 2.…
A: The development of CT and the discovery of X-rays both marked significant developments in medicine.…
Q: Write the dual purpose served by Deoxyribonucleoside triphosphates in polymerisation.
A: A deoxynucleoside triphosphate is essentially a nucleotide which is comprised of 3 phosphate groups…
Q: Discuss how modern agriculture can be changed to minimize environmental impacts.
A: The ways in which modern agriculture can be changed to minimize environmental effects are-…
Q: Match the description with the correct term. A. the idea that inherent variation in a population…
A: Evolutionary biology is the science of how evolution happens. Evolution is the mechanism of…
Q: Why is prompt treatment of pelvic inflammatory disease (PID) critical to reproductive health?
A: Introduction Pelvic inflammatory diseases are the diseases caused in the upper reproductive organs.…
Q: Fast fast fast
A: Introduction The cells are so minute structures that we cannot see them with unaided eyes, we…
Q: Give three characteristics of enzymes and describe how they permit chemical reactions to occur in…
A: Enzymes are protein molecules except for the ribozyme which is made up of RNA. Proteins are composed…
Q: ake this strand of DNA and a) Transcribe it, then b) Translate it. TAC GCA GTA ACA GGC CCT ATC a)…
A:
Q: Explain the term first-pass eject or hepatic metabolism of the drug. What effect does first-pass…
A: Introduction:- Drugs are the form or a type of medicine which are used to treat different types of…
Q: Edge effectsa. result from species crowding at edge of habitats.b. mean that no plants can grow well…
A: When two different types of habitat collide, a phenomenon known as the edge effect occurs. At the…
Q: Name the six fundamental properties of malignant tumours. Which of these properties are amenable to…
A: Malignant cells grow uncontrollably, invading nearby tissues and spreading to other parts of the…
Q: Which of the following is NOT a consequence of the shift to an agricultural way of life?
A: Introduction Agriculture is the practice of cultivating the land to grow crops and obtain food,…
Q: give example for food record/diary of weighed quantities of food consumed by an individual for 4 day
A: Weighed food diaries, often known as diet diaries or food records, are prospective dietary…
Q: The controlled exposure condition applies to the general public with no time restrictions. Select…
A: Controlled exposure means exposure to various ionizing radiations that include X-rays, gamma rays or…
Q: Methods of ATP production –aerobic, anaerobic and other – when are they used, how do they work, how…
A: Most cancer cells undergo aerobic respiration. Cancer cells have significant heterogeneity in…
Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC
A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…
Q: Match the description with the correct term. the idea that different mating calls of birds used…
A: Introduction :- A group of organisms known as a biological species can procreate with one another in…
Q: 5. Protein and blood cells are not found in the urine of healthy individuals. Patients with kidney…
A: Introduction Kidneys are the primary excretory organs in humans. They are associated with the…
Q: . A bacterium that does not have all the enzymes of central metabolism: a. Will not be a viable…
A: Central metabolism:- all those metabolomic reactions that provides energy, building block etc.…
Q: Please answer fast using the 7 characteristics listed , identify two things that always have all…
A: Living things The things which can move, grow, reproduce, have cell etc are considered as living…
Q: Describe post-transcriptional modifications that occur in mRNA and tRNA. Please type your answer.…
A: mRNA is known as massanger RNA. About 3-5% of the cellular RNA are of m-RNA type. It is linear in…
Q: . Write complete sentences using each of thefollowing terms to correctly describe the…
A: The science of nomenclature involves giving organisms names. The names are distinctive and…
Q: Why is it important to study evolution?
A: Change in the inheritable traits of biological populations over successive generations is referred…
Q: The expression levels for two genes measured at four times are: Compute the correlation…
A: The correlation coefficient's size reveals the degree of the link. A correlation of r = -0.2…
Q: The image above was taken using a 40x objective lens in our MoCell lab with 2.5 calibration factor.…
A: A microscope is an instrument that can be used to observe the small objects like, cells. The image…
Q: What are the functions of saliva?
A: Saliva is a clear liquid secreted by the salivary glands present in the mouth region. The saliva…
Q: Briefly describe the conditions of protein sample labeling and NMR sample. ?
A: Nuclear magnetic resonance or NMR is used to analyze the structure of a material. It analyzes the…
Q: Name the products of the citric acid cycle.
A: The citric acid cycle is also known as the TCA cycle. The TCA cycle occurs inside the mitochondrial…
Q: Explain how cells respond to external signals, even when those signals cannot enter the cell.
A: Introduction Cell signaling is the process in which different cells in the body of an organism…
Q: What's the primary difference between adult stem cells and embryonic stem cells? O A. Adult stem…
A: Stem cells have the capacity of generating different types of cell types that have different…
Q: What is the difference between direct and indirect measurements of metabolic rate? Recognize…
A: Introduction Metabolic rate means at which metabolism occurs in a living organism. Metabolic rate is…
Q: Molecules that are used for energy, how they feed into aerobic and anaerobic metabolism, which…
A: Metabolism is a sum total of anabolism and catabolism. Anabolism is any activity or reactions that…
Q: Explain the following areas about (Types of laboratory devices) 1. Who makes up the device or what…
A: The study of biology is a broad area of study. Scientists continually learn new things about the…
Q: 3. How would you manage patient's (eye) condition?
A: Introduction The human eye is the organ of the visual system which has the ability to receive visual…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
CCAGAGGTC
Replicate this DNA (answer in CAPS)
Step by step
Solved in 2 steps with 2 images
- Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC. Translate your answer to #16 using the table below. Second letter A G UGU cys UGC UUU PheUCU UCC UCA UCG UAU1 UUC UUA UAC J Tyr Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUGLEU CAUTHIS CÁC CUU CUC CUA CUG CCU] CCC CCA CCG CGU] CGC Arg Leu Pro CAA GIn CGA CGG. CAGS ACU ACC ACA AAC FAsn AAA AGU Ser AGC AGA LArg Lys AGGJ AUU AAU AUC le A AUA The AUG Mer ACG AAGJ GAU ASP GACJ GUU GCU GCC GCA GCG GGU GGC Gly GUC Val GUA Ala GAAG Glu GAGJ GGA GUG GGG Third letter DUAG JCAG DUAG C. First letterwhose properties suggest that they originated from transfer of foreign DNA into a bacterial cell.Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’
- #2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Complete the complementary stand of the DNA shown Complementary strand стАG GTACT CAC GEcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
- Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterEboV from Guinea pig Reference DNA Sample mRNA Protein
- Picture is only attached as reference. How does the model attached show DNA Replication?What is the importance of DNA Replication?What will happen if there will be an error during the DNA Replication Process?#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Historial Marcadores Ventana Ayuda 0 Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA polymerase DNA 5' 3' P つつつ 3' 5' RNA transcription A (4444 O carrollcc.instructure.com Edit View Insert Format Tools Table OO Hairpin loop (GC-rich) บบบบบบ 3′ RNA O е 12pt ✓ Paragraph | BIUA 2 T²V | V (LD) 5' ♫ tv A A Ċ 1 pts C T A