Bubble boy disease is a deficiency in adenosine deaminase that results in the accumulation of DADP. As a resu O The specificity of ribonucleotide reductase becomes unregulated and only pyrimidines are synthesized O Allosteric binding of excess DADP cause the R1 dimer to separate into monomers O The reaction equilibrium shifts and ribonucleotide reductase starts synthesizing ribonucleotides O The overall activity of ribonucleotide reductase is inhibited The tyrosil-radical site is disrupted by binding of excess DADP
Q: As a researcher you wish to know how well your newly discovered enzyme works compared to other known…
A: Enzyme immobilization is confinement of enzyme to a phase one of a kind from the only for substrates…
Q: Relate Gibbs free energy to the direction of a reaction in a cell assisted by enzyme how can a cell…
A: Enzymes are protein molecules that speed up cellular reactions by decreasing activation energy.…
Q: FUNCTION MONOMER POLYMER ELEMENTS CONTAINED EXAMPLE(S) MACROMOLECULE CARBOHYDRATES LIPIDS PROTEINS…
A: Biomolecules are carbon-based organic compounds. It consists of carbon, hydrogen, nitrogen, oxygen,…
Q: The data from thin layer chromatographic separation of analgesics showed ibuprofen distance to be…
A: Ibuprofen is solute here Distance travelled by Ibuprofen = 0.752 mm Distance travelled by solvent =…
Q: Biochemists talk about protein structure at four distinct levels: primary, secondary, tertiary and…
A: Primary Structure of protein is a linear sequence of amino acids that is linked by peptide/amide…
Q: If OAT takes ornithine and alpha-ketoglutarate as (a) substrates, draw the structures of the…
A: Aminotransferases are group of enzymes that catalyzes the transamination reaction between amino acid…
Q: Long explanations are not needed. Direct answers would suffice. ***kind of in a hurry so having the…
A: Maltose is a disaccharide, made up of two glucose units. Glycolysis involves the conversion of…
Q: Chemistry A poison has been found to severely compromise the energy production in its victims.…
A: Energy is produced in the mitochondrial matrix through the process of oxidative phosphorylation.…
Q: draw 3 allosteric enzyme curves for glycogen synthesis in the presence of high AMP, high NADH, and…
A: An allosteric enzyme is one that comprises a very small region that helps them in adapting to…
Q: What role does associative learning play in drug relapse? Be sure to include memory engrams and…
A: Drugs with habit resistance can trigger dopamine transmission in the shell when taken repeatedly.…
Q: Discuss the application of alpha and beta amylases in the food industry.
A: Amylases are a kind of enzyme that is widely employed in industry. These enzymes hydrolyze starch…
Q: How commonly do specific lipidmolecules associate with membraneproteins to regulate their function?
A: Lipids have a tendency to form the bilayer that helps in the passage of water-soluble materials…
Q: An acidic amino acid has a side chain that contains O a methyl group O an alcohol group O a carboxyl…
A: Question An acidic aminoacid has a side chain that contains Answer a carboxyl group.
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Elution and regeneration can be carried out in a single step. Explain using relevant examples.
A: In affinity chromatography, elution circumstances can have a direct effect on a quality related…
Q: High concentration of NADPH increases the rate of the pentose phosphate pathway by stimulating…
A: The pentose phosphate pathway converts glucose into ribose sugart in cytosol, the 5 step reaction…
Q: One process catalyzed by NADHNADH dehydrogenase is NADH+H^++ubiquinone ↽−−⇀…
A: Dehydrogenases catalyze the oxidation-reduction reaction by using coenzymes like NAD+/NADP+ or…
Q: Materials that allow flow of water are_______
A: Running fluid moves innately in a gravity-driven direction all along slope and finds its own way.…
Q: How do you measure antibiotic sensitivity?
A: Antibiotic susceptibility testing is the measurement of the sensitivity or resistance of a bacteria…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination can be described as the reaction of removal of α-amino nitrogen of amino acids by a…
Q: calculate the reaction velocity at saturating substrate concentrations. Your numerical answer is…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: What is the standard free energy (AGº) for the reduction of coenzyme Q by NADH as carried out by…
A: Coenzyme Q (CoQ, ubiquinone) is produced across all domains of life and functions in electron…
Q: a. Ribose-5-phosphate is produced by oxidative decarboxylation of 6-phosphogluconate catalyzed by…
A: pentose phosphate pathway is a metabolic pathway of hexose oxidation where glucose-6-phosphate is…
Q: Outline a metabolic pathway for the metabolism of two aspartic acids to CO2 and Urea. What is the…
A: The urea cycle is a series of biochemical processes that results in the formation of urea from…
Q: Using skeletal structures, draw the structure of a simple triacylglyceride containing 1…
A: Introduction: Triglycerides are esters of fatty acids that are hydrolyzed to glycerol and free…
Q: How many times larger is the number of hydrogen atoms than oxygen atoms in a molecule of glucose?
A: Carbohydrates can be defined as polyhydroxy aldehydes or ketones or compounds which yield these…
Q: 3. Below are the fates of the carbon skeletons of amino acids. Fill out the table with the…
A: The amino acids produced by catabolism of proteins might be recycled to form new proteins, be…
Q: a. Which of the following is FALSE about sucrose? i. It is a non-reducing sugar. ii. It is the…
A: Since there are multiple questions and they are not interlinked, as per our company guidelines only…
Q: 4. 1 3OH 12 HO, OH 5.
A: Introduction: The structure is of Ribose sugar. It is part of Polynucleotide. It's a furanose ring…
Q: What is the difference between the gane, sarson, and yourdon symbols in data and process modelling
A: Gane, sarson and yourdon are symbols which are used in data flow diagram. These symbols used to…
Q: Using skeletal structures, draw the structure of a simple triacylglyceride containing 1…
A: A triglyceride (TG, triacylglycerol, TAG, or triacylglycerol) is an ester made up of glycerol and…
Q: Which stereoisomer of the monosaccharide threose is shown below? a. D b. L c. R d. S
A:
Q: 14. Paracrine signaling is characterized by ligands that are A. produced by the target cells…
A: Paracrine signaling is a type of cell signaling in which the signals are released into the…
Q: na ligation and sticky-ehd produced from blunt-end iigation and sticky-end ligation (Hint: observe…
A: Biotechnology is a branch of science in which the life processes has been indulged with technology…
Q: Which of the following statements is CORRECT regarding the pentose phosphate pathway? a. It has two…
A: Introduction: The pentose phosphate pathway is also known as the hexose monophosphate pathway or…
Q: What carbon-containing molecule exits the citric acid cycle? Why doesn’t your body capture the…
A: The citric acid cycle can be defined as the central metabolic pathway in life forms that inhale…
Q: antibiotic
A: Antibiotics, also known as antibacterials, are medications that destroy or slow down the growth of…
Q: A culture of the single celled organism Chlamydomonas is actively carrying out photosynthesis in the…
A: Dark reaction is the second phase in photosynthesis where autotrophs uses carbon dioxide to…
Q: Compare splicing to alternative splicing, focusing on the purpose of alternative splicing, and…
A: Alternative splicing is an alternative splicing process of pre-mRNA during gene expression that…
Q: Which of the following shorthand names best characterizes the following disaccharide? a. Glc…
A: Carbohydrates are macronutrients and significant nutritional components. They can be formed as…
Q: 16. What is the membrane potential when the ratio of the ion concentration values is X-1) / X.
A: The membrane potential is at rest. the value of membrane potential will be negative for the given…
Q: Glycogen synthase kinase 3 beta (GSK-3ß) is a serine-threonine kinase known for its ability to…
A: The given graph is a double reciprocal plot or Lineweaver-burk Plot. Solution of question a) Line B…
Q: The phosphorylation of proteins is an important regulatory mechanism. a. Name three amino acids…
A: Phosphorylation of amino acids in protein is an important post-translational modification for…
Q: Löök at the diagram of a DNA molecule. Which of the letters W, X,Y and Z correspond to the following…
A: Deoxyribonucleic acid (DNA) is the molecule that conveys genetic information for growth and…
Q: Complete the following table by indicating the appropriate enzyme FULL names (from 1 to 4) affected…
A: The Krebs cycle (citric acid cycle) carry out the complete oxidation of acetyl CoA produced as the…
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: In the early mRNA elongation process, the 5' end of the nascent pre-mRNA is modified by addition of…
Q: Clinical significance of Hypouremia to BUN or urea
A: Hypo uremia - Uremia is s buildup of urea/toxins in our blood. then, Hypouremia is decrease in the…
Q: Question 40 A series of chemical reactions convert a polypeptide into 8 acetyl CoAs. This acetyl CoA…
A: 80 molecules of ATP are produced from 8 acetyl CoA. there is no standard units because this is a…
Q: 1. =0 Н—с —он Н—с —он Н—с —он CH2OH 2. нно н нонн онно I III TIT H-N-C-Ĉ-N-Ć-Ĉ-N-C-Ĉ-N--Ĉ-OH H-C-H…
A: Biological macromolecules can be classified into nucleic acids, proteins, lipids and carbohydrates.
Q: Which steps below require an ATP to run? O Phosphorylation Isomerization O Second Phosphorylation
A: ATP stands for adenosine triphosphate. This compound has a very high molar mass of around 507.18…
5
Step by step
Solved in 2 steps
- In the action of ribonucleotide reductase O A. a tyrosine residue removes a proton from the sugar ring O B. thioredoxin oxidizes a dithiol a tyrosine residue removes a hydrogen atom from the 2' OC position of the sugar ring a tyrosine residue donates a hydrogen atom from the 2" OD. position of the sugar ring O E. the 2' OH group is removed from the sugar ring as a water moleculeThe enzyme cytidine deaminase catalyzes the conversion of cytidine to uridine. Cytidine deaminase catalyzes the reaction through an addition of water across the cytidine 3,4-bond, forming a tetrahedral intermediate followed by the elimination of NH3 to form the product uridine. This is like the addition-elimination mechanism that we studied for adenosine deaminase. Cytidine deaminase НО. NH₂ N пOH OH cytosine R + H₂O cytidine The Km value for the substrate cytidine is 2.5 × 10-4 M, and the K; for competitive inhibition by the product uridine is 2.5 × 10-³ M. N R A reduced derivative of the product, 3,4,5,6-tetrahydrouridine was shown to be a fully reversible competitive inhibitor with a Ki of 2.4 x 10-7 M, a value approximately 10,000 times lower than that of the product uridine. NH₂ NH uridine HO. N R R = D-ribose HOH OH uridine 3NH uracil ring numbering H NH H H + NH3 H OH H 3,4,5,6-tetra- hydrouridine a.) Draw a structure of the intermediate that we predict to form during the…Many enzymes are switched "on" by attachment of a phosphate group at a specific serine somewhere on the protein (phosphorylation). The basic reaction is: E + ATP2 Ep + ADP Po SERINE PHOSPHO SERINC (Note the "squiggles" before the backone amide and carbonyl indicate the polypeptide chain continues on either side of the serine). For phosphorylation to have this effect, there has to be some equilibrium between inactive and active forms conformations of the enzyme: [Eactive] [Einactive] Einactive 2 Eactive; K* The same basic equilibrium must exist for the phosphorylated protein: [Ep,active] [Ep,inactive] EP,inactive 2 Ep,active; Kp = (a) If phosphorylation increases the measured activity of the enzyme, is K* or K larger? Why? (b) Does the phosphorylation site need to be near the site where the enzyme binds its substrate (e.g. the reactant whose chemistry it catalyzes)? Why or why not?
- Using abbreviations (not structures), write the reaction of flavin adenine dinucleotide that gives off energy (-AG). Match the items in the left column to the appropriate blanks in the equation on the right. H+ FADH → FADH3 + H+ 3/2H2 FADH3 FAD FADH 2H+ FADH2 3H+ H2The biosynthetic pathway for the two amino acides E and H is shown schematically in the Figure below: A W E 2 Z H How would this pathway change if C was mutated and non-functional?The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine 3'-monophosphate, cytosine 2'-monophosphate O B. Adenosine 2'-monophosphate, adenosine 3'-monophosphate, adenosine 21,5'-bisphosphate OC. Guanosine 2'-monophosphate, guanosine 3'-monophosphate, cytosine 3'-monophosphate O D. Cytidine 3'-monophosphate, guanosine 2'-monophosphate, adenine 2'-monophosphate O E. Adenine 3,5'-bisphosphate, guanine 2,5'-bisphosphate, uridine 2'-monophosphate O F. Uridine 2'-monophosphate, uridine 3'-monophosphate, guanine 3'-monophosphate
- What is the role of his 12 in the RNase-catalyzed hydrolysis of RNA, as indicated in the Figure below? 5' His 119 RNA CH₂ H H 3 O Base 1' 12' 8-H His 12 -P-0-CH₂ a Base H H O -0-P=O H OH NH It acts as a general base, abstracting a proton from the 2' hydroxyl in order to increase its nucleophilicity. It forms an H-bond with his119 in order to stabilize the transition state. It donates a proton to improve the quality of the leaving group. It works through concerted general acid-base catalysis with his119 in order to favour the products of the reaction. Two of the above are true.You are presented with Cytidine 5' triphosphate and Thymidine 5' triphosphate. Draw and upload to Efundi these phosphorylated structures as they would be connected in a polinucleotide in the order CpT / Show the individual phosphorylated structures first then show how they combine to form the polynuleotide. Show at any one of these structures where the glycosidic bond occursWhen performing his experiments on protein refolding, Christian Anfinsen obtained a quite different result when reduced ribonuclease was reoxidized while it was still in 8 M urea and the preparation was then dialyzed to remove the urea. Ribonuclease reoxidized in this way had only 1% of the enzymatic activity of the native protein. Why were the outcomes so different when reduced ribonuclease was reoxidized in the presence and absence of urea?
- In DNA sequencing by the Sanger method, the template strand of the DNA is radioactive specific enzymes are used to cut the DNA into small pieces which are then separated by electrophoresis dideoxy ATP (ddATP) is included in each of the four reaction mixtures before enzymatic synthesis of complementary strands the role of dideoxy CTP (ddCTP) is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands.Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro inTranslate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop