QUESTION 8 Where would you find eznymes with topoisomerase activity? Origin Quadrant Quadrant 5' 3' 3 3' Quadrant Quadrant 5' 4. Origin OL&Q OP&Q M & P OL&M ON
Q: BIOMOLECULES - Please answer the questions properly. - Multiple choice 1. Unsaturated fats are _____…
A: Introduction A biomolecule is a chemical compound found in living organisms, They are important for…
Q: A dental assistant is planning his/her continuing education courses for the new renewal cycle and is…
A: The primary analysis in dental care highlights the use of diagnostic and treatment techniques to…
Q: Secondary cell wall development and formation is lined and perforated by What?
A: Introduction: A cell wall is the non-living component that protects the cell's outer layer. It is…
Q: 1. During the Neolithlc Revolution, all humans switched from a hunter-gatherer lifestyle to an…
A: Human evolution is the long process through which humans evolved from their apelike predecessors.…
Q: 1.A plant can produce either a white flower or a purple flower, with the purple flower allele being…
A: The Punnett square is a square chart used to forecast genotypes in a cross or reproduction…
Q: Which of the following statements concerning SAR is NOT true? SAR members are defined by DNA…
A: Introduction The SAR supergroup comprises stramenopiles (heterokonts), alveolates, and Rhizaria. The…
Q: 23. Which of the following is NOT a characteristic of Clostridium species? А. They are Gram-positive…
A: Introduction Clostridium is a genus of Gram-positive bacteria. They can ferment a variety of…
Q: 54. Which of the following plant hormones causes delayed leaf senescence? а. ethylene b. auxin C.…
A: correct answer;- cytokinin Explain;-Cytokinins are plant-explicit synthetic couriers (chemicals)…
Q: Adrenal Gland: Structure, Function, and Mechanisms of Toxicity 1. How are the adrenal hormones…
A: Adrenal gland- Adrenal glands are also known as suprarenal glands. These glands are responsible for…
Q: 1. Name the structure at the red arrow. 2. What kind of epithelial tissue lines the structure at the…
A: It is the diagram of female reproductive system of human. Structure that pointed by red arrow is…
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: Hardy-Weinberg equation is important to study the population genetics of a particular species. This…
Q: Your unknown patient is patient 3. Here is the data that will enable your diagnosis: Unknown Case…
A: Introduction Diabetes is a long-term disease which affects the way our body converts food into…
Q: Write an account of Skeletal muscle contraction.
A: Introduction :- Skeletal muscles make up 30 to 40% of your total body weight. They're the muscles…
Q: b)Explain the differences between PMDIS and DPI
A: PMDIs are pressurized meter dose inhaler. Whereas DPI is Dry powder inhaler.
Q: Match the given step with the major central dogma event being referred to.
A:
Q: emdesivir is an antiviral drug that is currently being used to treat COVID-19. Which part of the…
A: Ans: Remdesivir is an antiviral medicine that originally first tested against the Ebola virus in…
Q: Question Discuss, How wil you characterize the Bing eating ?
A: Binge eating involves the consumption of large quantity of food very quickly, even when not hungry,…
Q: nternal structure of a flowering plant
A: Flowers are angiosperms’ organs of sexual reproduction; each structure’s design serves a specific…
Q: Describe how an adaptation, such as faster running speed, relates to natural selection. O Natural…
A: In natural selection nature selects organisms which are best fitted to changing environment. When…
Q: The dose to the body was 40 mSv. Find the dose to the Thyroid in mrem?
A: The mSv is the SI unit called milisievert. It measures the average of the accumulated radiation…
Q: Pa,ents with damage to the amygdala of their brains do not _____. a- feel pain b- recall images…
A: Brain is the complex part of our body which is made up of millions of neurones and it control…
Q: Proteins are always functional as single protein fibers with nothing attached can never form…
A: The correct answer is - proteins sometimes require additional molecules to be bound to them in order…
Q: ATP works in conjunction with motor proteins (such as cytoskeleton proteins) to make them move by…
A: Motor proteins convert chemical energy as a form of ATP to mechanical energy. This results…
Q: List down (in bullet form) and briefly describe (in maximum of 2 sentences each) three other fields…
A: The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences.
Q: Match the given step with the major central dogma event being referred to. An enzyme covalently adds…
A: Addition of 7-methyl guanosine triphosphate to the 5' end of pre-mRNA is a post transcriptional…
Q: A diploid plant has red flowers, heavy seeds and large leaves. The plant is a heterozygous for the…
A: The presence of two different alleles at a particular gene locus is called heterozygous.
Q: Elucidate the process how to diagnose starvation related problems in an aquaculture operation
A: Starvation is a process that begins after a meal is digested and extends until food is again…
Q: Phosphorylation is important in activating proteins because the addition of the phosphate group…
A: Protein structure may be used by scientists to explore the evolutionary links between various…
Q: To explain: The roles of photosynthesis, cellular respiration, combustion, and erosion in the carbon…
A: The stuff in the atmosphere flows in numerous cycles from one section of an ecosystem to another,…
Q: ATP works in conjunction with motor proteins (such as cytoskeleton proteins) to make them move by…
A: There are three types of motor protein in the eukaryotic cytoskeleton, they are microfilaments,…
Q: If you were to design a synthetic protein that would be used to increase support in synthetic heart…
A: Introduction:- The mitral, tricuspid, pulmonary, and aortic valves are the four heart valves that…
Q: Biology Describe how you might identify heterotic groups in hemp starting from a set of inbred…
A: inbred lines RILs can serve as powerful tools for genetic mapping. An RIL is formed by crossing two…
Q: Which of the following statements concerning SAR is NOT true? SAR members are defined by DNA…
A: SAR stands for systematic acquired resistance . It is the cell signaling molecules that provide…
Q: Biology Discuss the sequencing methods of the human genome used in 2000- the strength and…
A: The genome is a collection of biological instructions that are passed down from generation to…
Q: Describe the features that distinguish benign from malignant tumours, explaining the clinical…
A: Introduction :- When defective cells cluster together, a tumour arises. Bones, skin, tissue, organs,…
Q: Salting as a method of food preservation examples of food the can be preserved using such method…
A: Food preservation is done to reduce or stop the growth of microbes.
Q: speciation in the Galapagos finches occurred through geographic isolation
A:
Q: Carbon dioxide (CO?) is an example of a(n)
A: Introduction:- Carbon dioxide is a chemical molecule made up of one carbon atom and two oxygen…
Q: One laboratory method to detect for COVID-19 infection is via real time RT-PCR. The process starts…
A: Real-time RT–PCR is a nuclear-derived test for detecting the presence of RNA or DNA of the pathogen…
Q: A patient with poorly controlled Type I diabetes has blood drawn and finds that the pH of his blood…
A: Insulin and glucagon are hormones that assist control glucose levels in the body. To maintain…
Q: List the diseases in fish associated with deficiencies in essential amino acids.
A: Introduction In aquatic species, such as fish and shrimp, the role of amino acids in the diet is to…
Q: Biology 4. What is the survival and reproductive advantage for viruses that have a lysogenic or…
A: Viruses are very ideally defined in this they're purported to ve selective about selecting hosts and…
Q: Why do doctors place a sheet of lead over your body when you have x-rays done? Would the same be…
A: An X-ray machine is a machine that is mostly used for imaging. An X-ray machine, as the name…
Q: A defective gene on Chromosome 4 causes Huntington’s Disease. Everyone with this defective gene will…
A: Huntington's disease (HD) is a brain disorder which is handed down through generations in families.…
Q: Which is an incorrect statement about simple nerve nets? a- Neurons are randomly poisoned relative…
A: Answer :- Option (B) is correct. - They control the contraction and expansion of the gastrovascular…
Q: acteria Choose... rus Choose... otozoa Choose... ungi Choose... rchaea Choose... gae v Choose...…
A: Microbes are in the form of bacteria, fungi, viruses and protozoa. Most of these are unicellular.…
Q: What are the parts of a plant cell?
A: Plant cells are eukaryotic cells that differ from other eukaryotic organisms in a number of…
Q: Anemia is indicated in a patient's blood sample when the levels of hemoglobin fall below 15 g/100…
A: Hemoglobin is a protein present in red blood cells that carries oxygen to our body's organs and…
Q: Beadle and Tatum proposed the one-gene-one-polypeptide hypothesis. Is this true for prokaryotes and…
A: Answer
Q: As a municipal fisheries officer (MFO) you were assigned to investigate a report in the occurrence…
A: Aquaculture: Aquaculture is the controlled cultivation of aquatic animals such as fish,…
Step by step
Solved in 2 steps
- QUESTION 14 What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence immediately downstream of your target site. What happens? O It's fine because you put the PAM sequence in your guide RNA O PAM sequences only apply to real viral infections, not CRISPR assays. O The Cas9 nuclease won't cut at the target site O The guide RNA won't be complementary to the target O They'll be more off target effects but it'll still work.Question 15 When you successfully inserted a gene fragment into the Hindill site and transform bacteria with the plasmid. How can you tell which transformants have the insert? ... The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the enzyme ß-galactosidase, the product of which will turn bacterial colonies blue when grown in the presence of X-gal; the Amp gene confers ampicillin resistance. EcoRI Bam HI BamHI HindIII PSU922 BamHI Bam HI EcoRI ori C (A) The bacteria will not be able to grow in the presence of ampicillin, and they will be blue. B) The bacteria will not be able to grow in the presence of ampicillin, and they will be white. (C) The bacteria will be able to grow in the presence of ampicillin, and they will be white. (D) The bacteria will be able to grow in the presence of ampicillin, and they will be blue. AmpR F-gat1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8
- Transforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCOCTACGTGATAG...3' promoter A) Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'Step 1 Lys Lys Ligase-AMP NH2 NH2 NH2 `NH2 PP АТР он он OH Step 2 Lys Lys NH2 NH2 NH2 NH2 DNA- OH OH Adenylate OH OH HO. Step 3 NH2 NH2 NH2 NH2 AMP Phospho- diester OH OH OH OH OH Describe the mechanism shown above for DNA Ligase. Describe the chemistry of each step How the enzyme appears or might facilitate the chemistry How the enzyme increases the reaction rate.
- Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start siteEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG 3' Second letter UUU), Phe UCU UAU1. UGU UUC UCC UAC Tyr UGC Cys Ser UUA UCA UAA Stop UGA Stop UAG Stop UGG Trp Leu UUG UCG CU CCU CUC Leu CUA CC CCA CG CAU) His CAC. Pro CAA Gin CAG CGU CGC Arg CUG CGA CGG AAU AUU AUC le AUA AUG Met ACG ACU ACC AGU AAC Asn AGC Ser Thr ACA AAA) AGA AAG Lys AGG Arg GCU GCC GCA Ala GUU GAU GGU GUC Val GACJASP GGC G GAAT GGA Gly GUA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an ansWer. a silent frameshift nonsense missense Third letter First letter
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Question 3 In the polymerase chain reaction (A) conditions must be carefully controlled to prevent explosions. (B) reaction mixtures must be kept chilled at all times. C) it is possible to amplify small amounts of DNA without cloning. (D) primers should have a high G-C content and Tm at around 95°CCoding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'