Before the B-DNA was proposed by Watson and Crick, Pauling and Corey suggested a triple-stranded DNA model. Explain why Pauling's DNA model was not widely accepted by the scientific community.
Q: A/An________protein binds to the exposed end of a polymeric molecule preventing further…
A: ANSWER) Carrier protein A/An Carrier protein protein binds to the exposed end of a polymeric…
Q: Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green…
A: The L-arabinose operon, commonly known as the ara operon, is a gene sequence that encodes enzymes…
Q: The table below shows the number of individuals from 4 species of frogs sa a pond. What is the…
A: Shannon index considers species richness and species evenness.
Q: What are the main events of the first mitotic period?
A: Introduction - Mitosis is a phase of the cell cycle in which a cell's nucleus is divided into two…
Q: 12) Archaea are often used as an example of an evolutionary bridge from Bacteria to Eukaryote. List…
A: *Archaebacteria are a group of microorganisms which are believed to be evolved separately from…
Q: What function of the microtubule motor proteins dynein and kinesin is blocked by the use of…
A: Colchicine treatment to block microtubules motor proteins :-
Q: Given: Father - heterozygous for the H locus of the H antigen, heterozygous for the B locus of the…
A: Introduction Homozygous means that you inherit the same version of the gene from both parents,…
Q: • Part B a cotransformation experiment, using various mbinations of genes two at a time, the…
A: As you perform an experiment in which another Gene g was studied and it demonstrated positive…
Q: The leaf width of a particular plant has an environmental variance of 2.3 cm, an epistatic variance…
A: first in order to find narrow and broad sense heritability we have to find the total phenotypic…
Q: The way an individual's energy is divided among growth, maintenance, and reproduction is controlled…
A: In an ecosystem the availablity of resources for fulfilment of energy requirements not infinite. For…
Q: Question 7. What are the first three amino acids in the protein that is produced from this gene? -35…
A: mRNA is synthesized in the direction 5'-3'. The upper strand is called a template strand and the…
Q: Color in a species of minnows is determined by a single locus with two alleles: D and d. DD…
A: DD encodes darker phenotype. Dd encodes intermediate phenotype. dd encodes pale phenotype.
Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: Cancer is the stage of uncontrolled cell division due to failure of checkpoints at one or other…
Q: Assuming that the 30-nm chromatin fiber con-tains about 20 nucleosomes (200 bp/nucleosome) per 50nm…
A: Chromatin fibres are made up of nucleosomes, which are small discrete particles that form a…
Q: In a population with two alleles at the R locus (R and r), the frequency of the genotype rr is 0.10.…
A: Hardy Weinberg's principle describes the allele equilibrium in a population. The allele frequencies…
Q: In a population with two alleles at the R locus (R and r), the frequency of the genotype rr is 0.24.…
A: Introduction In population genetics, the Hardy–Weinberg principle, also known as the Hardy–Weinberg…
Q: Q.2. What is a bioreactor? Explain different types of bioreactors.
A: Bioreactors are large vessels used to carry out biological reactions and to culture aerobic cells…
Q: 1. Enumerate the 4 groups of coagulation factors according to function & opposite list the factors…
A: The normal range of platelets is up to 450,000 but if the number increased from this number it is…
Q: Q3.2. A guppy farmer currently rears a guppy population by first adding a few adults to a large pool…
A: guppy, also known as millionfish and rainbow fish, is one of the world's most widely distributed…
Q: The life table below is for a species of lizard. Use it to answer the questions below. It can be…
A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…
Q: Why is it important to keep individual samples separate? How many samples should an ecologist…
A: Introduction Ecologists often utilise one of three sampling methods. Coverage, abundance, and…
Q: ANSWER BRIEFLY: 3. Differentiate Bernard Soulier from Glanzmann's disease as to: a.…
A: a) Glanzmann thrombasthenia or GT is a kind of disorder majorly characterized by the impaired…
Q: Compare the excretory systems of a flatworm and an annelid worm. How are they similar? How are they…
A: Animal kingdom is a kingdom which comprises of Eukaryotic , heterotrophic organism . It comprises of…
Q: Q.14.How is Biotechnology useful in developing food crops and in agriculture process
A: Agricultural biotechnology encompasses a variety of strategies, includes conventional breeding,…
Q: What are the general features of DNA replication? 2.Why do some phages contain linear genomic DNA…
A: There are some general features of DNA replication; that is the semi-conservative synthesis of the…
Q: Which of the following agricultural practices can increase water pollution? a) Manual cultivating b)…
A: Introduction :- Genetically modified crops are agricultural plants whose DNA has been altered using…
Q: describe the main steps required to clone a gene and produce a protein.
A: Gene cloning is the technique of locating and copying (cloning) a gene of interest from all the DNA…
Q: In DrosophilaI, yellow body (y), crossveinless (cv), and forked bristles (f) are all found in the X…
A: According to the question, the map distance between Yellow and crossveinless =14 crossveinlessis…
Q: Which of the following statements about genetic drift is correct? Genetic drift causes predictable…
A: Genetic drift is an evolutionary change in the allelic frequency of a population as a matter of…
Q: about ATP synthase [Cellular Respiration] Which of the following interactions provides the…
A: ATP synthase It is an enzyme that is present on the inner side of the membrane and it catalyzes the…
Q: 3. Consider the chromosome pattern AAAXXY in Lychnis. What sex is this? a. Male b. Male with…
A: Chromosomes are thread-like structures found within the nucleus of both animal and plant cells.…
Q: What is the types of lymphocytes
A: Blood is a liquid connective tissue with liquid plasma and formed elements.
Q: 12. If the MW of human hemoglobin is 64,000g/mole, and its D, is 6.9X10" cm/s, what is its s value…
A: The Svedberg unit (Symbol S) is a measure of the sedimentation rate of a particle when centrifuged.…
Q: Which of the following situations could decrease the average fitness of a population? Snakes in a…
A: Introduction :- Fitness is a measure of an organism's ability to live and reproduce, with an…
Q: Is it enough or even possible to have resilience on the community level only?
A: Please follow step 2 for detailed explanation.
Q: Time passed and now that we are in the 21st century, is gene therapy successfully applied to human…
A: Jeans are the Statue of DNA that functional product in the form of protein. Expression of gene in…
Q: role of the innate immune system in initiating the acquired immune response.
A: Innate and acquired immunity Immunity is the ability of the body to fight diseases. Innate immunity…
Q: A community that does not undergo further succession is an apex community. True or false?
A: Introduction The process of change in an ecological community's species structure over time is…
Q: When one examines the pattern of inheritance of a deleterious gene and finds that it appears in…
A: Introduction Chromosomes are thread-like structures found within the nucleus of both animal and…
Q: A kid let go 8 snails he bought at the pet store in a pond. A year later, the population of snails…
A: A population exhibits a exponential growth when it grows in ideal environment which have unlimited…
Q: For each of the stages of the stages of change model, explain what an individual would be…
A: Stage of change Lose weight Stop gambling 1) Precontemplation Not currently considering change:…
Q: Identify the peculiarity in the maturation and development of megakaryocytic cells from the other…
A: All the blood cells , Erythrocytes,leucocytes,Megakaryocytes develops from a pluripotent stem cell.…
Q: Eye color in a species of fruitfly is determined by a single locus with two alleles: E and e. EE…
A: Hardy Weinberg equilibrium describes the allelic distribution of a population. The recessive allele…
Q: You're studying two lakes in neighboring valleys in the Cascades. One lake has a food web with three…
A: Based on the principles of trophic transfer, the lake with longer food web should have lower net…
Q: Inbreeding increases the frequency of ________ in a population. Question 73 options:…
A: Inbreeding is a term that indicates breeding between closely related individuals. On contrary,…
Q: The common carp is an non-native fish species in North America. A few individuals are introduced…
A: Population growth is the increase in the number of people in a population or a dispersed group.…
Q: Discuss the ecological importance of trematodes.
A: Introduction Trematoda is a subphylum of the Platyhelminthes phylum. It consists of two types of…
Q: Population health O Has no bearing on the overall health of the nation. O Does not include…
A: Population health refers to the health status and results inside a group of people. For general…
Q: _______ side is oriented towards the RER (transition vesicles with newly synthesized protein arrive…
A: Rough endoplasmic reticulum or RER is part of reticulum which has ribosomes attached to it's surface…
Q: How does the digestive system of a nematode or annelid differ from that of a flatworm? In what ways…
A: The complete digestive system is the tract that has two sorts of openings. One is the mouth from…
Step by step
Solved in 2 steps
- The image below was the basis of Watson and Crick to be able to elucidate the DNA structure. Explain/Discuss the meaning of this image as seen by Watson and Crick and how was it able to support the present-day structure of the Watson and Crick DNA?Describe the evidence that Watson and Crick used to construct their DNA model.X-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why is their finding not accepted by Watson and Crick? Explain.
- What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?Why didn't Rosalind Franklin get her due recognition for her work with DNA? A)All of the options are correct. B)Because it appeared she was only confirming the work of Watson and Crick. C)Because she died shortly after her discovery. D)The Because her publication was placed after Watson and Crick's.At that time, why did it seem reasonable for the bases to be on the outside of the DNA molecule and what evidence caused Watson and crick to revise this model?
- What did the Watson–Crick model suggest about the replication of DNA?State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixWhich of the following features is associated with the Watson and Crick model of the DNA? sugar-phosphate-base is the backbone of the helix B two antiparallel strands form the right-handed helix a purine always pair with a purine two antiparallel strands form the left handed helix
- Answer the following questions: What is the history of double-helix? What previous model were accepted prior to the Watson and Crick model?With regard to Chargaff’s experiment described in Figure shown,answer the following:A. What is the purpose of paper chromatography?B. Explain why it is necessary to remove the bases in order todetermine the base composition of DNA.C. Would Chargaff’s experiments have been convincing if theyhad been done on DNA from only one species? Discuss.Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’